BME103:W930 Group8 l2: Difference between revisions
Line 131: | Line 131: | ||
There are many different SNP's for the Prostate Cancer Gene. This is shown in OMIM database reference number [http://omim.org/entry/176807 176807]. The sequence for this phenotype is: | There are many different SNP's for the Prostate Cancer Gene. This is shown in OMIM database reference number [http://omim.org/entry/176807 176807]. The sequence for this phenotype is: | ||
<center> AGAGCTTGTAGGGAAAGGAAAACGCC''' | <center> AGAGCTTGTAGGGAAAGGAAAACGCC['''A'''/G]TCCTTTGAATAACAATTCTGAAATT.</center> | ||
The specific disease name for this SNP is sporadic prostate cancer. It is located on the 22nd chromosome with the Gene ID CHEK 2. The allele change is a G to a A in the positions 614 or 743. This change in the allele leads to an argine to histidine protein residues. This leads to an early onset prostate cancer. | The specific disease name for this SNP is sporadic prostate cancer. It is located on the 22nd chromosome with the Gene ID CHEK 2. The allele change is a G to a A in the positions 614 or 743. This change in the allele leads to an argine to histidine protein residues. This leads to an early onset prostate cancer. | ||
Line 140: | Line 140: | ||
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | ||
The primer design would be: | |||
Forward Primer | |||
<center> 3' CCTTTCCTTTTGCGG'''T'''AGG 5' </center> | |||
Reverse Primer | |||
<center> 3' CC'''A'''TCCTTTGAATAACAAT 5' </center> | |||
This is within the accepted bp primer length (18-22), follows the GC clamp rule (G or C within 5 bp of 3' to clamp the primer down), and has an annealing temperature of 61 degrees Celsius forward and 53 degrees Celsius backward. These all show that the primers forward and backward for this strand above would work. The primer also contains the mutation from the DNA sequence. This would be why the PCR product would give show a cancer gene if there was one, due to the cancerous allele being present. If the non-disease allele were present, the primer would not bind and thus would not amplify. | |||
Line 146: | Line 156: | ||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} |
Revision as of 22:59, 27 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features Heated Lid/PCR Block: Heat Sink/Fan: LCD Screen: Instructions Heat Sink/Fan LCD Screen
ProtocolsMaterials
Research and DevelopmentBackground on Disease Markers
The specific disease name for this SNP is sporadic prostate cancer. It is located on the 22nd chromosome with the Gene ID CHEK 2. The allele change is a G to a A in the positions 614 or 743. This change in the allele leads to an argine to histidine protein residues. This leads to an early onset prostate cancer.
Reverse Primer This is within the accepted bp primer length (18-22), follows the GC clamp rule (G or C within 5 bp of 3' to clamp the primer down), and has an annealing temperature of 61 degrees Celsius forward and 53 degrees Celsius backward. These all show that the primers forward and backward for this strand above would work. The primer also contains the mutation from the DNA sequence. This would be why the PCR product would give show a cancer gene if there was one, due to the cancerous allele being present. If the non-disease allele were present, the primer would not bind and thus would not amplify.
Illustration
|