BME103:W930 Group8 l2 - Revision history

James A Beauchamp: /* Thermal Cycler Engineering */

James A Beauchamp — Wed, 28 Nov 2012 18:42:38 GMT

Thermal Cycler Engineering

←Older revision		Revision as of 18:42, 28 November 2012
Line 83:		Line 83:
	'''12'''.Screw hinge to the back of the larger heated lid with black metal 8mm screws<br>		'''12'''.Screw hinge to the back of the larger heated lid with black metal 8mm screws<br>
	'''13'''.Screw all four shoulder bolts into the underside of the heated lid.<br>		'''13'''.Screw all four shoulder bolts into the underside of the heated lid.<br>
-	'''14'''.Thread and wires through hole in back of the heated lid.<br>	+	'''14'''.Thread and connect wires through hole in back of the heated lid.<br>
	'''15'''.Attach larger lid casing to larger heated lid using four black metal 8mm screws<br>		'''15'''.Attach larger lid casing to larger heated lid using four black metal 8mm screws<br>
	'''16'''.Screw heated lid handle into top of the lid<br>		'''16'''.Screw heated lid handle into top of the lid<br>

James A Beauchamp: /* Thermal Cycler Engineering */

James A Beauchamp — Wed, 28 Nov 2012 18:40:59 GMT

Thermal Cycler Engineering

←Older revision		Revision as of 18:40, 28 November 2012
Line 70:		Line 70:
	Thermal pad<br>		Thermal pad<br>

-	'''1'''.Snap one of the pieces into the top piece<br>	+	'''1'''.Snap one of the side pieces into the top piece<br>
	'''2'''.Slide the metal nut into the cross section <br>		'''2'''.Slide the metal nut into the cross section <br>
	'''3'''.Slide Metal 16mm screw through the hole on the top piece<br>		'''3'''.Slide Metal 16mm screw through the hole on the top piece<br>

Suzannah Badgett: /* Research and Development */

Suzannah Badgett — Wed, 28 Nov 2012 17:21:27 GMT

Research and Development

←Older revision		Revision as of 17:21, 28 November 2012
Line 202:		Line 202:
	<center> AGAGCTTGTAGGGAAAGGAAAACGCC['''A'''/G]TCCTTTGAATAACAATTCTGAAATT.</center>		<center> AGAGCTTGTAGGGAAAGGAAAACGCC['''A'''/G]TCCTTTGAATAACAATTCTGAAATT.</center>

-	The specific disease name for this SNP is sporadic prostate cancer~~. It is~~ located on the 22nd chromosome with the Gene ID CHEK 2. The allele change is a G to a A in the positions 614 or 743. This change in the allele leads to an argine to histidine protein residues. This leads to an early onset prostate cancer.	+	The specific disease name for this SNP is sporadic prostate cancer, located on the 22nd chromosome with the Gene ID CHEK 2. The allele change is a G to an A in the positions 614 or 743. This change in the allele leads to an argine to histidine protein residues. This leads to an early onset prostate cancer.

Suzannah Badgett: /* Research and Development */

Suzannah Badgett — Wed, 28 Nov 2012 17:18:58 GMT

Research and Development

←Older revision		Revision as of 17:18, 28 November 2012
Line 192:		Line 192:
	<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->		<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->

-	One gene we're choosing to examine is a gene that is linked to Alzheimer's Disease, which is a neurodegenerative disorder. Alzheimer's occurs by the misfolding of proteins, which result in clusters and aggregates of these misfolded proteins. Thus, proper function does not occur ~~results~~ in degeneration of neural cells, causing memory loss and other symptoms of Alzheimer's. The specific gene is [http://omim.org/entry/104760#0022 rs193922916]. The sequence for this gene is:	+	One gene we're choosing to examine is a gene that is linked to Alzheimer's Disease, which is a neurodegenerative disorder. Alzheimer's occurs by the misfolding of proteins, which result in clusters and aggregates of these misfolded proteins. Thus, proper function does not occur resulting in degeneration of neural cells, causing memory loss and other symptoms of Alzheimer's. The specific gene is [http://omim.org/entry/104760#0022 rs193922916]. The sequence for this gene is:
	<br><center> GGAGATCTCTGAAGTGAAGATGGATG'''[C/T]'''AGAATTCCGACATGACTCAGGATAT.		<br><center> GGAGATCTCTGAAGTGAAGATGGATG'''[C/T]'''AGAATTCCGACATGACTCAGGATAT.
	</center>		</center>

Suzannah Badgett: /* Research and Development */

Suzannah Badgett — Wed, 28 Nov 2012 17:18:33 GMT

Research and Development

←Older revision		Revision as of 17:18, 28 November 2012
Line 192:		Line 192:
	<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->		<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) --->

-	One gene we're choosing to examine is a gene that is linked to Alzheimer's Disease, which is a neurodegenerative disorder. Alzheimer's occurs by the misfolding of proteins, which result in clusters and aggregates of these misfolded proteins. Thus ~~they do not~~ function ~~as they should and result~~ in degeneration of neural cells, causing memory loss and other symptoms of Alzheimer's. The specific gene is [http://omim.org/entry/104760#0022 rs193922916]. The sequence for this gene is:	+	One gene we're choosing to examine is a gene that is linked to Alzheimer's Disease, which is a neurodegenerative disorder. Alzheimer's occurs by the misfolding of proteins, which result in clusters and aggregates of these misfolded proteins. Thus, proper function does not occur results in degeneration of neural cells, causing memory loss and other symptoms of Alzheimer's. The specific gene is [http://omim.org/entry/104760#0022 rs193922916]. The sequence for this gene is:
	<br><center> GGAGATCTCTGAAGTGAAGATGGATG'''[C/T]'''AGAATTCCGACATGACTCAGGATAT.		<br><center> GGAGATCTCTGAAGTGAAGATGGATG'''[C/T]'''AGAATTCCGACATGACTCAGGATAT.
	</center>		</center>

Suzannah Badgett: /* Protocols */

Suzannah Badgett — Wed, 28 Nov 2012 17:14:05 GMT

Protocols

←Older revision		Revision as of 17:14, 28 November 2012
Line 181:		Line 181:
	'''Image J Protocol'''		'''Image J Protocol'''

-	The images from the device were then uploaded onto a computer that was enabled with Image J software. These photos were uploaded into the Image J program and the DNA samples were analyzed.	+	The images from the device were then uploaded onto a computer that was enabled with Image J software. These photos were uploaded into the Image J program and the DNA samples were analyzed and measured. Analysis included using the software to split the color channels into three criteria. The green channel is used for measurement and analysis of the drop sample.

	==Research and Development==		==Research and Development==

Naomi Welch: /* Protocols */

Naomi Welch — Wed, 28 Nov 2012 17:08:56 GMT

Protocols

←Older revision		Revision as of 17:08, 28 November 2012
Line 122:		Line 122:
	\|		\|
	\|-		\|-
-	\| ~~Material~~ \|\|\|\| Amount	+	\| Supplied In Kit \|\|\|\| Amount
	\|-		\|-
	\| 10 μM Forward Primer \|\|\|\| 2.5 μL		\| 10 μM Forward Primer \|\|\|\| 2.5 μL
Line 163:		Line 163:
	\|		\|
	\|-		\|-
-	\| ~~Supplied in Kit~~\|\|\|\| Amount	+	\| Material \|\|\|\| Amount
	\|-		\|-
	\| Flourimeter \|\|\|\| 1		\| Flourimeter \|\|\|\| 1

Naomi Welch: /* Protocols */

Naomi Welch — Wed, 28 Nov 2012 17:07:56 GMT

Protocols

←Older revision		Revision as of 17:07, 28 November 2012
Line 122:		Line 122:
	\|		\|
	\|-		\|-
-	\| ~~Supplied in Kit~~\|\|\|\| Amount	+	\| Material \|\|\|\| Amount
	\|-		\|-
	\| 10 μM Forward Primer \|\|\|\| 2.5 μL		\| 10 μM Forward Primer \|\|\|\| 2.5 μL

Suzannah Badgett: /* Thermal Cycler Engineering */

Suzannah Badgett — Wed, 28 Nov 2012 16:33:23 GMT

Thermal Cycler Engineering

←Older revision		Revision as of 16:33, 28 November 2012
Line 89:		Line 89:
	'''18'''.Attach enlarged thermal pad to 40 sample PCR block<br>		'''18'''.Attach enlarged thermal pad to 40 sample PCR block<br>
	'''19'''.Attach the following parts from top to bottom in the order as follows: 40 sample PCR Block - Thermal pad - peltier - adapter plate - thermal pad - heat sink.<br>		'''19'''.Attach the following parts from top to bottom in the order as follows: 40 sample PCR Block - Thermal pad - peltier - adapter plate - thermal pad - heat sink.<br>
-	'''20'''. Mount the PCR Block to the enlarge mounting plate using eight (instead of four as before) 5mm diameter screws and washers<br>	+	'''20'''.Mount the PCR Block to the enlarge mounting plate using eight (instead of four as before) 5mm diameter screws and washers<br>

	Heat Sink/Fan<br>		Heat Sink/Fan<br>

Suzannah Badgett: /* Thermal Cycler Engineering */

Suzannah Badgett — Wed, 28 Nov 2012 16:32:45 GMT

Thermal Cycler Engineering

←Older revision		Revision as of 16:32, 28 November 2012
Line 68:		Line 68:
	5 mm diameter screws(8)<br>		5 mm diameter screws(8)<br>
	5 mm diameter washers (8)<br>		5 mm diameter washers (8)<br>
-	~~thermal~~ pad<br>	+	Thermal pad<br>

	'''1'''.Snap one of the pieces into the top piece<br>		'''1'''.Snap one of the pieces into the top piece<br>
Line 81:		Line 81:
	'''10'''.Screw Together the lid heater and mountin plate with allen wrench and black metal 8mm screws<br>		'''10'''.Screw Together the lid heater and mountin plate with allen wrench and black metal 8mm screws<br>
	'''11'''.Screw the latch to the larger lid bracket with black metal 8mm screws<br>		'''11'''.Screw the latch to the larger lid bracket with black metal 8mm screws<br>
-	'''12'''. Screw hinge to the back of the larger heated lid with black metal 8mm screws<br>	+	'''12'''.Screw hinge to the back of the larger heated lid with black metal 8mm screws<br>
	'''13'''.Screw all four shoulder bolts into the underside of the heated lid.<br>		'''13'''.Screw all four shoulder bolts into the underside of the heated lid.<br>
	'''14'''.Thread and wires through hole in back of the heated lid.<br>		'''14'''.Thread and wires through hole in back of the heated lid.<br>