BME103:W930 Group9: Difference between revisions
Line 128: | Line 128: | ||
'''Specific Cancer Marker Detection - The Underlying Technology'''<br> | '''Specific Cancer Marker Detection - The Underlying Technology'''<br> | ||
'''What Does PCR Do?''' | |||
DNA strands across human beings are very similar, but there is a correlation between the discrepancies between DNA sequences and phenotypic conditions such as cancer or heart disease. Because DNA is so small, and has so many components, it is not reasonable to simply look through the entire strand for the sequence of interest. This report used a technique that amplified specific DNA strands which is called Polymerase Chain Reaction or PCR. This technique uses a primer that identifies and replicates a specific Single Nuleotide Polymorphism(SNP), if present. For this to work, the DNA strand and primer need to go through a cycle of temperature shifts that allow the DNA to replicate. The steps are denaturing, annealing and extension. The pr | |||
'''Looking at rs17879961(CHEK2)''' | |||
To explain how this method is used, we will consider the sequence, rs17879961. This specific sequence is found on chromosome 22, has been named CHEK2, and is associated with colorectal and breast cancer. | |||
Normal | Normal | ||
GTGGGTCCTAAAAACTCTTACA[T]TGCATACATAGAAGATCACAGTGGC | GTGGGTCCTAAAAACTCTTACA[T]TGCATACATAGAAGATCACAGTGGC | ||
Cancer | Cancer | ||
GTGGGTCCTAAAAACTCTTACA[C]TGCATACATAGAAGATCACAGTGGC <br> | GTGGGTCCTAAAAACTCTTACA[C]TGCATACATAGAAGATCACAGTGGC <br> | ||
Revision as of 08:09, 14 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design The open PCR is a device that enables the splitting of DNA. It is run through many cycles of heating and cooling that enables the splitting and recombination with polomers. It connects to a computer program to run the cycles. The temperature change is controled by the heating lid and than the information is fed to the LED screen. The heating lid heats tubes that are held in the heat tube holder to the appropriate temperature and then cools them as needed in each cycle. Experimenting With the Connections When we unplugged part 3, the LCD, from part 6, the Open PCR Brains Board, the LCD on the machine stopped working and did not show anything on it. When we unplugged the white wire that connects part 6, the Open PCR Brains Board, to part 2, the heat tube, the machine no longer measures the temperature of the plate and sends it to the LCD.
First test run: 24 Oct. 2012
ProtocolsPolymerase Chain Reaction Procedure for amplifying a person’s DNA
The Samples
Flourimeter procedure 1. Place the flourimeter on the table and turn on the blue light. Instructions for opening images in imageJ
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology DNA strands across human beings are very similar, but there is a correlation between the discrepancies between DNA sequences and phenotypic conditions such as cancer or heart disease. Because DNA is so small, and has so many components, it is not reasonable to simply look through the entire strand for the sequence of interest. This report used a technique that amplified specific DNA strands which is called Polymerase Chain Reaction or PCR. This technique uses a primer that identifies and replicates a specific Single Nuleotide Polymorphism(SNP), if present. For this to work, the DNA strand and primer need to go through a cycle of temperature shifts that allow the DNA to replicate. The steps are denaturing, annealing and extension. The pr Looking at rs17879961(CHEK2) To explain how this method is used, we will consider the sequence, rs17879961. This specific sequence is found on chromosome 22, has been named CHEK2, and is associated with colorectal and breast cancer.
GTGGGTCCTAAAAACTCTTACA[T]TGCATACATAGAAGATCACAGTGGC Cancer GTGGGTCCTAAAAACTCTTACA[C]TGCATACATAGAAGATCACAGTGGC (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)
Results
|