BME103:W930 Group9 l2: Difference between revisions
Hamas Asaad (talk | contribs) |
Seth Howell (talk | contribs) |
||
(3 intermediate revisions by one other user not shown) | |||
Line 152: | Line 152: | ||
The disease our group chose to look at was cystic fibrosis. It is a recessive trait caused by mutations in a gene on the 7th chromosome that "Causes thick, sticky mucus to build up in the lungs, digestive tract, and other areas of the body"([http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001167/]). This disease is life threatening and has a prevalence (at birth) of 1 in 2000 to 3000 in Europe and 1 in 3500 in the U.S. [http://www.who.int/genomics/public/geneticdiseases/en/index2.html]. The marker used is a two nucleotide deletion and has identy rs200007348 and a description of the phenotype along with location in the chromosome. can be found at [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=200007348].<br> | The disease our group chose to look at was cystic fibrosis. It is a recessive trait caused by mutations in a gene on the 7th chromosome that "Causes thick, sticky mucus to build up in the lungs, digestive tract, and other areas of the body"([http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001167/]). This disease is life threatening and has a prevalence (at birth) of 1 in 2000 to 3000 in Europe and 1 in 3500 in the U.S. [http://www.who.int/genomics/public/geneticdiseases/en/index2.html]. The marker used is a two nucleotide deletion and has identy rs200007348 and a description of the phenotype along with location in the chromosome. can be found at [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=200007348].<br> | ||
'''Primer Design''' | |||
'''Primer Design'''<br> | |||
Forward primer<br> | Forward primer<br> | ||
5'AAAAAAACAATCTTTTAAACAC3'<br> | 5'AAAAAAACAATCTTTTAAACAC3'<br> | ||
Line 158: | Line 159: | ||
3'TGTTTACTTACCGTAGCTTC5'<br> | 3'TGTTTACTTACCGTAGCTTC5'<br> | ||
The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.<br> | The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.<br> | ||
'''Illustration''' | '''Illustration''' | ||
<br> | |||
[[Image:Cf1.png|250px|DNA Amplification]] | [[Image:Cf1.png|250px|DNA Amplification]] | ||
<br> | |||
The first sequence is the original. The second shows the change that occurs, the deletion of the ∆F508, and this will be picked up by the PCR. | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} |
Latest revision as of 18:07, 28 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||
OUR TEAMEveryone has contributed to this project even though there are only two usernames. Every person used these two users to make edits to the wiki. Dr. Haynes said that this would be sufficient enough to give each member full participation credit for this project LAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
The KeyPad will be detachable, and will be connected through the USB connection. Key Features
The key features of the new design include a larger main heating block and a Instructions The new OpenPCR will be assembled and operated almost identical to the old OpenPCR.
ProtocolsMaterials
PCR Protocol *important* Use one pipet for each transfer do not reuse the pipet. 3. After the DNA priming mixture is transferred move each tube into the PCR machine. a. Enter in the number of parts the heating portion will have(example First cycle, Main cycle and Last cycle=3).
1. Place the flourimeter on the table and turn on the blue light. 1. Take a picture of the fluorimeter assembly with a smartphone. Research and DevelopmentBackground on Disease Markers
Illustration
The first sequence is the original. The second shows the change that occurs, the deletion of the ∆F508, and this will be picked up by the PCR. |