BME103:W930 Group9 l2: Difference between revisions
Seth Howell (talk | contribs) |
|||
(12 intermediate revisions by 2 users not shown) | |||
Line 111: | Line 111: | ||
'''PCR Protocol'''<br> | '''PCR Protocol'''<br> | ||
1. Plug PCR machine in and attach the keypad to USB. <br> | 1. Put 0.2 micro liters of DNA in each test tube. <br> | ||
2. Use a micropipet and transfer the 98.8 micro liters DNA priming mixture to each test tube containing 0.2 micro liters of DNA.<br> | |||
a. Enter in the number of parts the heating portion will have(example First | *important* Use one pipet for each transfer do not reuse the pipet.<br> | ||
*The DNA priming mixture consists of the forward and back primers, nucleotides, and DNA polymerase.*<br> | |||
3. After the DNA priming mixture is transferred move each tube into the PCR machine.<br> | |||
4. Plug PCR machine in and attach the keypad to USB. <br> | |||
5. Programming the PCR heating procedure:<br> | |||
a. Enter in the number of parts the heating portion will have(example First cycle, Main cycle and Last cycle=3).<br> | |||
b. Enter the number of cycles for each part in order<br> | b. Enter the number of cycles for each part in order<br> | ||
c. Enter temperature of each cycle in order. <br> | c. Enter temperature of each cycle in order. <br> | ||
d. place all the test tubes prepared in steps 3 | d. place all the test tubes prepared in steps 1-3 in heating pad<br> | ||
e. press * to begin the heating program and wait until the process is complete. <br> | e. press * to begin the heating program and wait until the process is complete. <br> | ||
'''Flourimeter instructions'''<br> | |||
''' | 1. Place the flourimeter on the table and turn on the blue light.<br> | ||
2. Place provided glass slide on flourimeter track so that the first row of dots is even with the light.<br> | |||
3. Place phone cradle in front of the flourimeter with a smart phone facing perpendicular to the beam of light. (as seen in the picture). <br> | |||
4. Add two drops of green dye on the dots that are even with the light.<br> | |||
5. Place two drops of DNA sample on top of the green dye.<br> | |||
6. Cover the flourimeter and phone by turning the large box over and placing it above both of them.<br> | |||
7. Take a picture of the droplet with the camera.<br> | |||
8. Save the picture and send it to the imageJ operator.<br><br> | |||
I'''nstructions for opening images in imageJ'''<br> | |||
1. Take a picture of the fluorimeter assembly with a smartphone.<br> | |||
2. Transfer the picture to a laptop equipped with imageJ via icloud or email.<br> | |||
3. Open imageJ and select file, then hit open.<br> | |||
4. Find the file on the computer and select it.<br> | |||
5. The image is now open and can be analyzed.<br> | |||
6. The image can be split into three images (blue, green, and red) for better analysis by selecting: image-color-split channels.<br> | |||
1. Take a picture of the fluorimeter assembly with a smartphone. | |||
2. Transfer the picture to a laptop equipped with imageJ via icloud or email. | |||
3. Open imageJ and select file, then open. | |||
4. Find the file on the computer and select it. | |||
5. The image is now open and can be analyzed. | |||
6. The image can be split into three images (blue, green, and red) for better analysis by selecting: image-color-split channels. | |||
==Research and Development== | ==Research and Development== | ||
Line 153: | Line 153: | ||
'''Primer Design'''<br> | |||
'''Primer Design''' | |||
Forward primer<br> | Forward primer<br> | ||
5'AAAAAAACAATCTTTTAAACAC3'<br> | 5'AAAAAAACAATCTTTTAAACAC3'<br> | ||
Line 162: | Line 159: | ||
3'TGTTTACTTACCGTAGCTTC5'<br> | 3'TGTTTACTTACCGTAGCTTC5'<br> | ||
The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.<br> | The disease allele will give a positive result in open pcr because both the forward and reverse primers match that allele perfectly. The non-disease allele will not give a positive result because there is a frameshift mutation between the two alleles. Two nucleotides are added into the non-disease allele (between the second, and third nucleotides before the 5' end of the reverse primer). This means that the first two nucleotides willl bind to the reverse primer, but the rest will not, and exponential replication of the disease-carrying allele will be impossible.<br> | ||
'''Illustration''' | '''Illustration''' | ||
<br> | |||
[[Image:Cf1.png|250px|DNA Amplification]] | [[Image:Cf1.png|250px|DNA Amplification]] | ||
<br> | |||
The first sequence is the original. The second shows the change that occurs, the deletion of the ∆F508, and this will be picked up by the PCR. | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} |
Latest revision as of 18:07, 28 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||
OUR TEAMEveryone has contributed to this project even though there are only two usernames. Every person used these two users to make edits to the wiki. Dr. Haynes said that this would be sufficient enough to give each member full participation credit for this project LAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
The KeyPad will be detachable, and will be connected through the USB connection. Key Features
The key features of the new design include a larger main heating block and a Instructions The new OpenPCR will be assembled and operated almost identical to the old OpenPCR.
ProtocolsMaterials
PCR Protocol *important* Use one pipet for each transfer do not reuse the pipet. 3. After the DNA priming mixture is transferred move each tube into the PCR machine. a. Enter in the number of parts the heating portion will have(example First cycle, Main cycle and Last cycle=3).
1. Place the flourimeter on the table and turn on the blue light. 1. Take a picture of the fluorimeter assembly with a smartphone. Research and DevelopmentBackground on Disease Markers
Illustration
The first sequence is the original. The second shows the change that occurs, the deletion of the ∆F508, and this will be picked up by the PCR. |