BME103 s2013:T900 Group4 L3: Difference between revisions
Line 100: | Line 100: | ||
* [Want #2 - why? short, ~4 or 5 sentences]--> | * [Want #2 - why? short, ~4 or 5 sentences]--> | ||
- Low cost: OpenPCR $599 Fluorimeter $300. | - Low cost: Currently an OpenPCR machine costs $599 and a Fluorimeter costs $300. An inexpensive material would help reduce cost and increase accessibility, since there is always a limited budget for new equipment. This would not only allow users to increase the amount of tests that can be run at the same time, but also boost sales, which is important for marketing any device. | ||
- integrated camera: phone cameras are easily moveable and vary in size and quality, leading to differing results. Smartphone camera settings can be time consuming or nonexistent. Having a built-in camera increases cost, but it is worth it to increase speed and accuracy. Furthermore, the program is simpler because it does not have to adjust to different cameras and phone sizes and shapes vary enough to make building a cradle to fit them difficult. | |||
Revision as of 02:06, 16 April 2013
BME 103 Spring 2013 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 3 WRITE-UPOriginal System: PCR ResultsPCR Test Results
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.
New System: Design StrategyWe concluded that a good system Must Have: - easily determined results: The easier the results are to read accurately, the less likely a misdiagnosis in either direction. It is undesirable both to give a false negative, where a patient is not treated when care is needed, or to give a false positive, wasting time and resources on those who do not need them. This aspect is central to any diagnostic tool. - Simple OpenPCR Software: Simplicity increases ease and efficiency in lab experiments and hopefully leads to faster diagnoses. It also makes troubleshooting easier should problems arise. The more straightforward the system, the more quickly users can learn to use the machine. We concluded that we would Want a good system to have: - Low cost: Currently an OpenPCR machine costs $599 and a Fluorimeter costs $300. An inexpensive material would help reduce cost and increase accessibility, since there is always a limited budget for new equipment. This would not only allow users to increase the amount of tests that can be run at the same time, but also boost sales, which is important for marketing any device. - integrated camera: phone cameras are easily moveable and vary in size and quality, leading to differing results. Smartphone camera settings can be time consuming or nonexistent. Having a built-in camera increases cost, but it is worth it to increase speed and accuracy. Furthermore, the program is simpler because it does not have to adjust to different cameras and phone sizes and shapes vary enough to make building a cradle to fit them difficult.
- Troublesome USB Connectivity. USB connectivity should function well in order for OpenPCR machine to work. - Casing = fire hazard. High temperature with PCR can be dangerous.
We concluded that a good system Should Avoid: - Avoid slow amplification. - Hard to adjust phone/ fluorimeter. The phone can be easily moved by accident, which requires readjustment between the phone and the fluorimeter.
New System: Machine/ Device EngineeringSYSTEM DESIGN
KEY FEATURES
Step 1: Connect the base to the fluorimeter.
New System: ProtocolsDESIGN
MATERIALS
New System: Research and DevelopmentBACKGROUND
DESIGN
GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC
New System: Software[THIS SECTION IS OPTIONAL. If your team has creative ideas for new software, and new software is a key component included in your new protocols, R&D, or machine design, you may describe it here. You will not receive bonus points, but a solid effort may raise your overall page layout points. If you decide not to propose new software, please delete this entire section, including the ==New System: Software== header.]
|