BME103 s2013:T900 Group4 L3: Difference between revisions
Anna Essex (talk | contribs) |
|||
(51 intermediate revisions by 2 users not shown) | |||
Line 15: | Line 15: | ||
| [[Image:Smile_Group4.jpg|120px|thumb|Name: Kinjal Ahir Role:Protocol]] | | [[Image:Smile_Group4.jpg|120px|thumb|Name: Kinjal Ahir Role:Protocol]] | ||
| [[Image:133834815227.jpg|120px|thumb|Name: Zach Young <br>Initial Machine Testing]] | | [[Image:133834815227.jpg|120px|thumb|Name: Zach Young <br>Initial Machine Testing]] | ||
| [[Image: | | [[Image:OregonLove.jpg|120px|thumb|Name: Anna Essex <br>Initial Machine Testing]] | ||
| [[Image:Smile_Group4.jpg|120px|thumb|Name: Tuan Phan <br>Research and Design]] | | [[Image:Smile_Group4.jpg|120px|thumb|Name: Tuan Phan <br>Research and Design]] | ||
| [[Image:BME103_Group4Vergil_ODST.jpg|120px|thumb|Name: Amelia Lax <br>Research and Design]] | | [[Image:BME103_Group4Vergil_ODST.jpg|120px|thumb|Name: Amelia Lax <br>Research and Design]] | ||
Line 28: | Line 28: | ||
{| {{table}} | {| {{table}} | ||
|- | |- | ||
| Sample Name || Ave. INTDEN* || Calculated (μg/mL) || Conclusion (pos/neg) | | '''Sample Name''' || '''Ave. INTDEN*''' || '''Calculated (μg/mL)''' || '''Conclusion (pos/neg)''' | ||
|- | |- | ||
| Positive Control || 1,450,385 || 1.60 || pos | | Positive Control || 1,450,385 || 1.60 || pos | ||
Line 52: | Line 52: | ||
These following conditional statistics are based upon all of the DNA detection system results that were obtained in the PCR lab for 20 hypothetical patients who were diagnosed as either having cancer or not having cancer.<br> | These following conditional statistics are based upon all of the DNA detection system results that were obtained in the PCR lab for 20 hypothetical patients who were diagnosed as either having cancer or not having cancer.<br> | ||
<br> | <br> | ||
Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B) | ''Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B)'' | ||
Calculation 1: The probability that the sample actually has the cancer DNA sequence, given a positive diagnostic signal.<br> | '''Calculation 1:''' The probability that the sample actually has the cancer DNA sequence, given a positive diagnostic signal.<br> | ||
* A = frequency of cancer-positive conclusions = 9 / 20 = 0.45 | * A = frequency of cancer-positive conclusions = 9 / 20 = 0.45 | ||
* B = frequency of positive PCR reactions = 26 / 60 = 0.43 | * B = frequency of positive PCR reactions = 26 / 60 = 0.43 | ||
Line 62: | Line 62: | ||
<br> | <br> | ||
'''Calculation 2:''' The probability that the sample actually has a non-cancer DNA sequence, given a negative diagnostic signal.<br> | |||
Calculation 2: The probability that the sample actually has a non-cancer DNA sequence, given a negative diagnostic signal.<br> | |||
* A = frequency of cancer-negative conclusions = 11 / 20 = 0.55 | * A = frequency of cancer-negative conclusions = 11 / 20 = 0.55 | ||
* B = frequency of negative PCR reactions = 34 / 60 = 0.57 | * B = frequency of negative PCR reactions = 34 / 60 = 0.57 | ||
Line 70: | Line 69: | ||
<br> | <br> | ||
Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.<br> | '''Calculation 3:''' The probability that the patient will develop cancer, given a cancer DNA sequence.<br> | ||
* A = frequency of "yes" cancer diagnosis = 9 / 20 = 0.45 | * A = frequency of "yes" cancer diagnosis = 9 / 20 = 0.45 | ||
* B = frequency of "pos" test conclusion = 26 / 60 = 0.43 | * B = frequency of "pos" test conclusion = 26 / 60 = 0.43 | ||
Line 77: | Line 76: | ||
<br> | <br> | ||
'''Calculation 4:''' The probability that the patient will not develop cancer, given a non-cancer DNA sequence.<br> | |||
Calculation 4: The probability that the patient will not develop cancer, given a non-cancer DNA sequence.<br> | |||
* A = frequency of "no" cancer diagnosis = 11 / 20 = 0.55 | * A = frequency of "no" cancer diagnosis = 11 / 20 = 0.55 | ||
* B = frequency of "neg" test conclusion = 34 / 60 = 0.57 | * B = frequency of "neg" test conclusion = 34 / 60 = 0.57 | ||
Line 92: | Line 90: | ||
* [Must have #2 - why? short, ~4 or 5 sentences]--> | * [Must have #2 - why? short, ~4 or 5 sentences]--> | ||
* Easily Determined Results: The easier the results are to read accurately, the less likely a misdiagnosis in either direction. It is undesirable both to give a false negative, where a patient is not treated when care is needed, or to give a false positive, wasting time and resources on those who do not need them. This aspect is central to any diagnostic tool. | |||
* Simple Software: Simplicity increases ease and efficiency in lab experiments and hopefully leads to faster diagnoses. It also makes troubleshooting easier should problems arise. The more straightforward the system, the more quickly users can learn to use the machine. | |||
'''We concluded that we would ''Want'' a good system to have:''' | '''We concluded that we would ''Want'' a good system to have:''' | ||
Line 100: | Line 99: | ||
* [Want #2 - why? short, ~4 or 5 sentences]--> | * [Want #2 - why? short, ~4 or 5 sentences]--> | ||
* Low Cost: Currently an OpenPCR machine costs $599 and a fluorimeter costs $300. An inexpensive material would help reduce cost and increase accessibility, since there is always a limited budget for new equipment. This would not only allow users to increase the amount of tests that can be run at the same time, but also boost sales, which is important for marketing any device. | |||
* Integrated Camera: Phone cameras are easily moveable and vary in size and quality, leading to differing results. Adjusting smartphone camera settings can be time consuming or, in some models, impossible. Having a built-in camera increases cost, but it is worth it to increase speed and accuracy. This also simplifies the software is because the PCR does not have to adjust to different cameras. Finally, phone sizes and shapes vary enough to make building a universal cradle to fit them difficult. | |||
Line 109: | Line 108: | ||
* [Must Not Have #2 - why? short, ~4 or 5 sentences]--> | * [Must Not Have #2 - why? short, ~4 or 5 sentences]--> | ||
* Unpredictable USB Connectivity: USB connectivity should function well and consistently in order for the PCR machine to work. This also reduces troubleshooting time and is a fairly simple problem to fix in a new system's design. | |||
* Flammable Casing: The PCR rapidly cycles through different temperatures, some extremely high. As with other electronics, the wires and other electrical components could overheat or spark. At the very least, the wooden casing currently used could damage the machine beyond repair, and at worst, lead to massive fires in areas with expensive equipment and many people. Simply changing the casing to a material like plexiglass would solve this problem. | |||
Line 121: | Line 117: | ||
* [Should Avoid #2 - why? short, ~4 or 5 sentences]--> | * [Should Avoid #2 - why? short, ~4 or 5 sentences]--> | ||
* Slow Amplification: Increasing the speed of diagnosis would make the test more efficient and possibly allow for a verdict while the patient is still in the doctor's office without spending an inordinate amount of time. However, speed will be sacrificed if need be to accommodate more important features such as accuracy. | |||
* Movable Phone or Fluorimeter: In the current system, which uses a smartphone in a cradle instead of a built-in camera, the phone or fluorimeter can be easily moved by accident, which requires readjustment and can possibly skew results. Using the current setup decreases accuracy but also decreases cost. We placed accuracy as more important than cost, but the opportunity to reduce price if the machine is too costly keeps this idea from being completely rejected. | |||
<br><br> | <br><br> | ||
Line 144: | Line 136: | ||
<br> | <br> | ||
Rather than drastically change a fairly-efficient PCR machine, we decided that the fluorimeter setup was more in need of modification. The only change to the PCR machine would be improved USB ports, but the fluorimeter would have a built-in camera to remove the complications of positioning a camera phone. The phone would still be used to run the machine, but it wouldn't directly take the pictures. This new camera would take the place of the current cradle and be at a fixed position in respects to the fluorimeter for most efficient photographing. Also, the slots on the board of the fluorimeter would be labeled to avoid confusion in the process of analysis. | Rather than drastically change a fairly-efficient PCR machine, we decided that the fluorimeter setup was more in need of modification. The only change to the PCR machine would be improved USB ports, but the fluorimeter would have a built-in camera to remove the complications of positioning a camera phone. The phone would still be used to run the machine, but it wouldn't directly take the pictures. This new camera would take the place of the current cradle and be at a fixed position in respects to the fluorimeter for most efficient photographing. Also, the slots on the board of the fluorimeter would be labeled to avoid confusion in the process of analysis. | ||
Line 152: | Line 141: | ||
<!-- If your team decided to change any of the machinery/ devices, summarize the new features here and delete the '''We chose keep the devices the same as the original system''' section. --> | <!-- If your team decided to change any of the machinery/ devices, summarize the new features here and delete the '''We chose keep the devices the same as the original system''' section. --> | ||
''Fluorimeter | ''Fluorimeter - We chose to include these new features:'' | ||
* Integrated Camera - helps reduce inconsistency of photography and time-consuming difficulty of positioning | * '''Integrated Camera''' - helps reduce inconsistency of photography and time-consuming difficulty of positioning | ||
* Labeled slots - reduces likelihood of error from misidentified photographs | * '''Labeled slots''' - reduces likelihood of error from misidentified photographs | ||
<br> | |||
<!-- If your team decided NOT to change any of the machinery/ devices, explain why here and delete the '''We chose to include these new features''' section above--> | <!-- If your team decided NOT to change any of the machinery/ devices, explain why here and delete the '''We chose to include these new features''' section above--> | ||
''PCR Machine | ''PCR Machine - We chose keep these features the same as the original system:'' | ||
* Reliable Hardware - the machine is sturdy and does its job efficiently considering its simple construction | * '''Reliable Hardware''' - the machine is sturdy and does its job efficiently considering its simple construction | ||
* Preexisting Software - the current Open PCR software is well developed and user-friendly | * '''Preexisting Software''' - the current Open PCR software is well developed and user-friendly | ||
Line 171: | Line 161: | ||
*Step 4: Take photo.<br> | *Step 4: Take photo.<br> | ||
*Step 5: Upload photo for necessary manipulation. <br> | *Step 5: Upload photo for necessary manipulation. <br> | ||
<br> | |||
==New System: Protocols== | ==New System: Protocols== | ||
'''DESIGN''' | '''DESIGN'''<br> | ||
<!-- If your team decided to change the PCR and/or the Fluorimeter imaging protocols, summarize the new approaches/ features here and delete the '''We chose keep the protocols the same as the original system''' section. | <!-- If your team decided to change the PCR and/or the Fluorimeter imaging protocols, summarize the new approaches/ features here and delete the '''We chose keep the protocols the same as the original system''' section. | ||
'''We chose to include these new approaches/ features''' | '''We chose to include these new approaches/ features''' | ||
Line 185: | Line 171: | ||
* Feature 2 - explanation of how this addresses any of the specifications in the "New System: Design Strategy" section | * Feature 2 - explanation of how this addresses any of the specifications in the "New System: Design Strategy" section | ||
* Etc.--> | * Etc.--> | ||
We chose to modify the hardware of the fluorimeter. However, overall protocols should remain the same. | |||
We chose to | |||
<!-- If your team decided NOT to change any of the machinery/ devices, explain why here and delete the '''We chose to include these new features''' section above | <!-- If your team decided NOT to change any of the machinery/ devices, explain why here and delete the '''We chose to include these new features''' section above | ||
'''We chose keep the protocols the same as the original system''' | '''We chose keep the protocols the same as the original system''' | ||
Line 193: | Line 177: | ||
* Feature 2 - explanation of how a pre-existing feature addresses any of the specifications in the "New System: Design Strategy" section | * Feature 2 - explanation of how a pre-existing feature addresses any of the specifications in the "New System: Design Strategy" section | ||
* Etc.--> | * Etc.--> | ||
As the PCR machine was not modified, its protocols will also remain unaltered. | |||
<br> | |||
<br> | |||
'''MATERIALS''' | '''MATERIALS''' | ||
{| {{table}} width=700 | ::{| {{table}} width=700 | ||
|- | |- | ||
| '''Supplied in the Kit''' || '''Amount''' | | '''Supplied in the Kit''' || '''Amount''' | ||
|- | |- | ||
| | | Camera Unit || 1 | ||
|- | |- | ||
| Reaction mix|| | | Reaction mix|| 400μL | ||
|- | |- | ||
| Battery || | | Battery || 1 | ||
|- | |- | ||
| Software || | | Software || freeware | ||
|} | |} | ||
{| {{table}} width=700 | ::{| {{table}} width=700 | ||
|- | |- | ||
| '''Supplied | | '''Supplied by the User''' || '''Amount''' | ||
|- | |- | ||
| Filter water || | | Filter water || 1,000μL | ||
|- | |- | ||
| SYBR Green || | | SYBR Green || 2,000μL | ||
|- | |- | ||
| Primers || | | Primers || 4,000μL | ||
|- | |- | ||
| DNA sample (negative and positive)|| | | DNA sample (negative and positive)|| 400μL | ||
|} | |} | ||
Line 229: | Line 212: | ||
* '''PCR Protocol''' | * '''PCR Protocol''' | ||
<!-- Create a step-by-step procedure for setting up and running PCR reactions. Your instructions should include everything from adding reagents to the tubes, to programming the PCR machine and running the reaction.--> | <!-- Create a step-by-step procedure for setting up and running PCR reactions. Your instructions should include everything from adding reagents to the tubes, to programming the PCR machine and running the reaction.--> | ||
# | # Obtain and label 8 50μL DNA samples (4 each from 2 patients, positive control, negative control) and 8 50μL tubes of PCR reaction mix | ||
# | # Set micropipette to 75μL and attach disposable tip | ||
# | # Transfer all of the liquid from positive control DNA sample to a reaction mix tube, discard tip, label tube | ||
# Repeat for the remaining 7 DNA samples | |||
# Set the PCR program to run three stages <br> | |||
::{| {{table}} width=500 | |||
|- | |||
| '''Stage''' || '''Number of Cycles''' || '''Temperature (°C)''' || '''Duration''' | |||
|- | |||
| 1 || 1 || 95 || 3 minutes | |||
|- | |||
| 2 || 35 || 95 || 30 seconds | |||
|- | |||
| || n/a || 57 || 30 seconds | |||
|- | |||
| || n/a || 72 || 30 seconds | |||
|- | |||
| 3 || n/a || 72 || 3 minutes | |||
|- | |||
| Final hold || n/a || 4 || n/a | |||
|} | |||
:6. Load the mixed tubes into the PCR machine, close the lid, run the program | |||
:7. Remove tubes at end of program | |||
* '''DNA Measurement and Analysis Protocol''' | * '''DNA Measurement and Analysis Protocol''' | ||
<!-- Create a step-by-step procedure for measuring DNA amplification in the PCR reactions. Your instructions should include everything from diluting the samples in SYBR Green, to placing the drops onto the fluorimeter (if your group is using the fluorimeter), to collecting and processing images in Image J. Don't forget to provide instructions on how to set up the calf thymus DNA samples for calibration, and how to convert INTDEN values into concentrations.---> | <!-- Create a step-by-step procedure for measuring DNA amplification in the PCR reactions. Your instructions should include everything from diluting the samples in SYBR Green, to placing the drops onto the fluorimeter (if your group is using the fluorimeter), to collecting and processing images in Image J. Don't forget to provide instructions on how to set up the calf thymus DNA samples for calibration, and how to convert INTDEN values into concentrations.---> | ||
# | # Obtain a tray of sample tubes (8 buffer, 2 SYBR GREEN, 1 H<sub>2</sub>O, 5 calf Thymus DNA, 8 PCR reaction samples) | ||
# | # Set micropipette to 120μL and attach disposable tip | ||
# | # Transfer all of the liquid from positive control PCR sample to a buffer tube, discard tip, label tube | ||
# | # Repeat for the remaining 7 PCR samples | ||
# | # Calibrate the fluorimeter using the calf thymus DNA samples of known concentration | ||
# | #*Set up the integrated camera and adjust the settings, connect the smartphone to the camera for control | ||
# | #*Place 80μL of SYBR GREEN I onto the slide so it forms a definite drop, add 80μL of DNA, align with the LED | ||
#*Cover the fluorimeter with the light box and use phone to take picture | |||
#*Remove the box, remove the drop, export picture to computer for analysis (Make sure to label!) | |||
# In ImageJ, adjust the settings and split the color channels of the image to select green | |||
# Draw an oval around the image and measure, repeat for background | |||
# Repeat for the remaining concentrations of calf thymus DNA | |||
# Use these readings and the known DNA concentrations to create a graph with a linear fit for calculating concentration based on INTDEN values | |||
# Using the same procedure, repeat with the unknown DNA samples from the patients and use the graph to calculate DNA concentration | |||
<br> | |||
==New System: Research and Development== | ==New System: Research and Development== | ||
'''BACKGROUND''' | '''BACKGROUND'''<br> | ||
<!--- A description of the CHEK2 gene, it's associated SNP, and the cancer-related function of the gene. Use the information from your Week 13 worksheet. ---> | <!--- A description of the CHEK2 gene, it's associated SNP, and the cancer-related function of the gene. Use the information from your Week 13 worksheet. ---> | ||
CHEK2 is a gene located at chromosome 22. It provides instructions for making protein called checkpoint kinase 2, a tumor suppressor. This particular protein responds to damage in DNA, preventing the cell from entering mitosis when the cell's DNA deviates from normal. Mutations of CHEK2 gene can lead to breast cancer, Li-Fraumeni syndrome, and other type cancers and diseases. The mutation targeted by our primers is a single base change from adenine to cytosine at position 29121087, the cytosine variant being cancerous. | |||
CHEK2 is a gene located at chromosome 22. It provides instructions for making protein | <br><br> | ||
'''DESIGN'''<br> | |||
'''DESIGN''' | In our design, we chose to use primers for both normal and cancer-associated DNA sequences so users can cross-check their results. For example, if a patient's test returns positive for the cancer-associated allele, the test can be run with a normal allele primer to ensure that the test results were accurate, in which case the test for the normal allele should be negative. This addition of primers associated with the normal sequence allows users to test for the presence of normal DNA if they suspect that the cancer-associated DNA is not present. This helps fulfill our goal of making a more reliable test. It takes more time to run more samples, but it provides an extra layer of caution to help ensure correct diagnosis. | ||
<br><br> | |||
'''Primers for PCR'''<br> | '''Primers for PCR'''<br> | ||
<!-- If your team decided to only amplify cancer-associated DNA, list the "Cancer allele forward primer" sequence and the "Cancer allele reverse primer" sequence. Include a paragraph that explains why a disease allele will give a PCR product and the non-disease allele will not.--> | <!-- If your team decided to only amplify cancer-associated DNA, list the "Cancer allele forward primer" sequence and the "Cancer allele reverse primer" sequence. Include a paragraph that explains why a disease allele will give a PCR product and the non-disease allele will not.--> | ||
Normal Allele<br> | |||
Forward Primer: TATGTATGCAATGTAAGAGTT<br> | |||
Reverse Primer: TGAACCACTGGTGAAAAGAAC<br> | |||
Cancerous Allele<br> | |||
Forward Primer: ATACATACGTGACATTCTCAA<br> | |||
Reverse Primer: TGAACCACTGGTGAAAAGAAC | |||
<br><br> | |||
<!-- If your team chose an alternative approach to amplify the DNA, list all relevant primers. Include a paragraph that explains how your system works.--> | <!-- If your team chose an alternative approach to amplify the DNA, list all relevant primers. Include a paragraph that explains how your system works.--> | ||
'''Our primers address the following design needs'''<br> | |||
'''Our primers address the following design needs''' | * Easily Determined Results: As we considered diagnostic accuracy absolutely essential to a new system, the inclusion of a normal forward and reverse primer acts as a second layer of security and a way users can double-check results. This makes the system slightly more expensive and take more time, but both of those aspects were considered adjustable rather than absolute. | ||
* | |||
Line 275: | Line 285: | ||
==New System: Software== | ==New System: Software== | ||
As has been seen by the several groups who already have software in development, the need for more efficient PCR and image analysis capabilities are growing. For our particular machine, an app allowing a smartphone to control the integrated fluorimeter camera would be most essential, and ideally this app could also perform image analysis, lessening the complication of transferring large quantities of images that all look very similar to the human eye. <br> | |||
<br> | |||
As ImageJ is a Java-based program, converting it to an Android app would be fairly straightforward. Similarly, channeling a phone to control an external camera is nothing particularly revolutionary but would greatly increase the efficiency and accuracy of this lab. Open PCR software could also be streamlined to run more quickly and give more accurate readouts during runtime. In reality, software modifications would provide the most improvement for this lab with relatively little effort. | |||
Latest revision as of 08:13, 16 April 2013
BME 103 Spring 2013 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 3 WRITE-UPOriginal System: PCR ResultsPCR Test Results
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Calculation 2: The probability that the sample actually has a non-cancer DNA sequence, given a negative diagnostic signal.
Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.
Calculation 4: The probability that the patient will not develop cancer, given a non-cancer DNA sequence.
New System: Design StrategyWe concluded that a good system Must Have:
New System: Machine/ Device EngineeringSYSTEM DESIGN
Fluorimeter - We chose to include these new features:
PCR Machine - We chose keep these features the same as the original system:
New System: ProtocolsDESIGN
New System: Research and DevelopmentBACKGROUND Cancerous Allele
New System: SoftwareAs has been seen by the several groups who already have software in development, the need for more efficient PCR and image analysis capabilities are growing. For our particular machine, an app allowing a smartphone to control the integrated fluorimeter camera would be most essential, and ideally this app could also perform image analysis, lessening the complication of transferring large quantities of images that all look very similar to the human eye.
|