BME103 s2013:T900 Group4 L3: Difference between revisions
Anna Essex (talk | contribs) |
Anna Essex (talk | contribs) |
||
Line 51: | Line 51: | ||
'''Bayesian Statistics'''<br> | '''Bayesian Statistics'''<br> | ||
These following conditional statistics are based upon all of the DNA detection system results that were obtained in the PCR lab for 20 hypothetical patients who were diagnosed as either having cancer or not having cancer.<br> | These following conditional statistics are based upon all of the DNA detection system results that were obtained in the PCR lab for 20 hypothetical patients who were diagnosed as either having cancer or not having cancer.<br> | ||
<br> | |||
Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B) | Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B) | ||
Line 62: | Line 62: | ||
<br> | <br> | ||
Calculation 2: The probability that the sample actually has a non-cancer DNA sequence, given a negative diagnostic signal.<br> | Calculation 2: The probability that the sample actually has a non-cancer DNA sequence, given a negative diagnostic signal.<br> | ||
* A = frequency of cancer-negative conclusions = [frequency shown as a fraction] = [final numerical value] | * A = frequency of cancer-negative conclusions = [frequency shown as a fraction] = [final numerical value] | ||
* B = frequency of negative PCR reactions = [frequency shown as a fraction] = [final numerical value] | * B = frequency of negative PCR reactions = [frequency shown as a fraction] = [final numerical value] | ||
* P (B|A) = frequency of negative PCR given cancer-negative conclusion = [frequency shown as a fraction] = [final numerical value] | * P (B|A) = frequency of negative PCR given cancer-negative conclusion = [frequency shown as a fraction] = [final numerical value] | ||
* '''P(A|B) = [answer]''' | * '''P(A|B) = [answer]''' | ||
<br> | <br> | ||
Line 77: | Line 77: | ||
<br> | <br> | ||
Calculation 4: The probability that the patient will not develop cancer, given a non-cancer DNA sequence.<br> | Calculation 4: The probability that the patient will not develop cancer, given a non-cancer DNA sequence.<br> | ||
* A = frequency of "no" cancer diagnosis = [frequency shown as a fraction] = [final numerical value] | * A = frequency of "no" cancer diagnosis = [frequency shown as a fraction] = [final numerical value] | ||
* B = frequency of "neg" test conclusion = [frequency shown as a fraction] = [final numerical value] | * B = frequency of "neg" test conclusion = [frequency shown as a fraction] = [final numerical value] | ||
* P (B|A) = frequency of neg given no = [frequency shown as a fraction] = [final numerical value] | * P (B|A) = frequency of neg given no = [frequency shown as a fraction] = [final numerical value] | ||
* '''P(A|B) = [answer]''' | * '''P(A|B) = [answer]''' | ||
<br> | <br> | ||
Revision as of 00:47, 16 April 2013
BME 103 Spring 2013 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 3 WRITE-UPOriginal System: PCR ResultsPCR Test Results
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.
New System: Design StrategyWe concluded that a good system Must Have: - Result easy to determine. - Simple OpenPCR Software: The OpenPCR Software shoulder be simple and easy to use and that would help lab experiments done faster, rather than the need to spend extra time to figure out how the software works. We concluded that we would Want a good system to have: - Low cost: OpenPCR $599 Fluorimeter $300. A low cost material would help since there is always a limited budget for the research experiment. This would allow us to buy more OpenPCR and fluorimeter and create more data results in the same amount of time. Phone camera should not be easily moveable when played in front of the fluorimeter. Phone camera adjustment can be time consuming and not setting it in the correct position/distance results data error.
- Troublesome USB Connectivity. USB connectivity should function well in order for OpenPCR machine to work. - Casing = fire hazard. High temperature with PCR can be dangerous.
We concluded that a good system Should Avoid: - Avoid slow amplification. - Hard to adjust phone/ fluorimeter. The phone can be easily moved by accident, which requires readjustment between the phone and the fluorimeter.
New System: Machine/ Device EngineeringSYSTEM DESIGN
KEY FEATURES
Step 1: Connect the base to the fluorimeter.
New System: ProtocolsDESIGN
MATERIALS
New System: Research and DevelopmentBACKGROUND
DESIGN
GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC
New System: Software[THIS SECTION IS OPTIONAL. If your team has creative ideas for new software, and new software is a key component included in your new protocols, R&D, or machine design, you may describe it here. You will not receive bonus points, but a solid effort may raise your overall page layout points. If you decide not to propose new software, please delete this entire section, including the ==New System: Software== header.]
|