BME103 s2013:T900 Group4 L3

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(Original System: PCR Results)
(New System: Design Strategy)
Line 92: Line 92:
* [Must have #2 - why? short, ~4 or 5 sentences]-->
* [Must have #2 - why? short, ~4 or 5 sentences]-->
-
- Result easy to determine.
+
- easily determined results: The easier the results are to read accurately, the less likely a misdiagnosis in either direction. It is undesirable both to give a false negative, where a patient is not treated when care is needed, or to give a false positive, wasting time and resources on those who do not need them. This aspect is central to any diagnostic tool.  
    
    
-
- Simple OpenPCR Software: The OpenPCR Software shoulder be simple and easy to use and that would help lab experiments done faster, rather than the need to spend extra time to figure out how the software works.
+
- Simple OpenPCR Software: Simplicity increases ease and efficiency in lab experiments and hopefully leads to faster diagnoses. It also makes troubleshooting easier should problems arise. The more straightforward the system, the more quickly users can learn to use the machine.
'''We concluded that we would ''Want'' a good system to have:'''
'''We concluded that we would ''Want'' a good system to have:'''

Revision as of 03:52, 16 April 2013

BME 103 Spring 2013 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Kinjal Ahir Role:Protocol
Name: Kinjal Ahir Role:Protocol
Name: Zach Young Initial Machine Testing
Name: Zach Young
Initial Machine Testing
Name: Anna Essex Initial Machine Testing
Name: Anna Essex
Initial Machine Testing
Name: Tuan Phan Research and Design
Name: Tuan Phan
Research and Design
Name: Amelia Lax Research and Design
Name: Amelia Lax
Research and Design

LAB 3 WRITE-UP

Original System: PCR Results

PCR Test Results

Sample Name Ave. INTDEN* Calculated (μg/mL) Conclusion (pos/neg)
Positive Control 1,450,385 1.60 pos
Negative Control 488,789 0.18 neg
Tube Label: B2 Patient ID: 17818 rep 1 709,603 0.51 pos
Tube Label: C2 Patient ID: 17818 rep 2 642,405 0.41 pos
Tube Label: D2 Patient ID: 17818 rep 3 417,721 0.07 neg
Tube Label: B1 Patient ID: 85158 rep 1 450,174 0.12 neg
Tube Label: C1 Patient ID: 85158 rep 2 387,850 0.03 neg
Tube Label: D1 Patient ID: 85158 rep 3 376,360 0.01 neg

* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images


Bayesian Statistics
These following conditional statistics are based upon all of the DNA detection system results that were obtained in the PCR lab for 20 hypothetical patients who were diagnosed as either having cancer or not having cancer.

Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B)


Calculation 1: The probability that the sample actually has the cancer DNA sequence, given a positive diagnostic signal.

  • A = frequency of cancer-positive conclusions = [frequency shown as a fraction] = [final numerical value]
  • B = frequency of positive PCR reactions = [frequency shown as a fraction] = [final numerical value]
  • P (B|A) = frequency of positive PCR given cancer-positive conclusion = [frequency shown as a fraction] = [final numerical value]
  • P(A|B) = [answer]



Calculation 2: The probability that the sample actually has a non-cancer DNA sequence, given a negative diagnostic signal.

  • A = frequency of cancer-negative conclusions = [frequency shown as a fraction] = [final numerical value]
  • B = frequency of negative PCR reactions = [frequency shown as a fraction] = [final numerical value]
  • P (B|A) = frequency of negative PCR given cancer-negative conclusion = [frequency shown as a fraction] = [final numerical value]
  • P(A|B) = [answer]


Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.

  • A = frequency of "yes" cancer diagnosis = [frequency shown as a fraction] = [final numerical value]
  • B = frequency of "pos" test conclusion = [frequency shown as a fraction] = [final numerical value]
  • P (B|A) = frequency of pos given yes = [frequency shown as a fraction] = [final numerical value]
  • P(A|B) = [answer]



Calculation 4: The probability that the patient will not develop cancer, given a non-cancer DNA sequence.

  • A = frequency of "no" cancer diagnosis = [frequency shown as a fraction] = [final numerical value]
  • B = frequency of "neg" test conclusion = [frequency shown as a fraction] = [final numerical value]
  • P (B|A) = frequency of neg given no = [frequency shown as a fraction] = [final numerical value]
  • P(A|B) = [answer]


New System: Design Strategy

We concluded that a good system Must Have:

- easily determined results: The easier the results are to read accurately, the less likely a misdiagnosis in either direction. It is undesirable both to give a false negative, where a patient is not treated when care is needed, or to give a false positive, wasting time and resources on those who do not need them. This aspect is central to any diagnostic tool.

- Simple OpenPCR Software: Simplicity increases ease and efficiency in lab experiments and hopefully leads to faster diagnoses. It also makes troubleshooting easier should problems arise. The more straightforward the system, the more quickly users can learn to use the machine.

We concluded that we would Want a good system to have:

- Low cost: OpenPCR $599 Fluorimeter $300. A low cost material would help since there is always a limited budget for the research experiment. This would allow us to buy more OpenPCR and fluorimeter and create more data results in the same amount of time.

Phone camera should not be easily moveable when played in front of the fluorimeter. Phone camera adjustment can be time consuming and not setting it in the correct position/distance results data error.


We concluded that a good system Must Not Have:

- Troublesome USB Connectivity. USB connectivity should function well in order for OpenPCR machine to work.

- Casing = fire hazard. High temperature with PCR can be dangerous.



We concluded that a good system Should Avoid:

- Avoid slow amplification.

- Hard to adjust phone/ fluorimeter. The phone can be easily moved by accident, which requires readjustment between the phone and the fluorimeter.





New System: Machine/ Device Engineering

SYSTEM DESIGN


We decided to have some addition of the fluorimeter to allow easy adjustment and positioning of the phone. The benefit of this addition is that it will help save time to try to readjust the phone in the correct position, and that photos can be taken better and more accurate, which give better and accurate data results.



KEY FEATURES


This new device will hold the camera phone in place. It will be able to connect temporarily to the fluorimeter, allowing the phone to be held in place. The device will also have an adjustable distance from the phone to the fluorimeter, as well as the height for more compability of other different phones, without trying to adding more heights to the phone or the fluorimeter.




INSTRUCTIONS

Step 1: Connect the base to the fluorimeter.
Step 2: Set the camera phone into the base.
Step 3: Set the height and distance.
Step 4: Take Photo.




New System: Protocols

DESIGN


We chose to add an extra device to the fluorimeter. However, protocols should remain the same.


MATERIALS

Supplied in the Kit Amount
Smart phone 1
Reaction mix given more for more reactions
Battery
Software
Supplied in the User Amount
Filter water
SYBR Green
Primers
DNA sample (negative and positive)



PROTOCOLS

  • PCR Protocol
  1. Step 1: Reaction mix
  2. Step 2: Add 2.5 μL of negative and positive DNA sample
  3. Step 3: Fluorometer gave the sample result


  • DNA Measurement and Analysis Protocol
  1. Step 1: Set up the equipment
  2. Step 2: Put the smart phone and fluorometer in the dark box
  3. Step 3: Major the distance between the fluorometer and phone.
  4. Step 4: Run the samples
  5. Step 5: Take a picture of the experiment
  6. Step 6: Repeat this trial with different samples
  7. Step 7: Use Image J and make a circle around the drop.




New System: Research and Development

BACKGROUND


CHEK2 is a gene located at chromosome 22. It provides instructions for making protein call checkpoint kinase 2. The checkpoint kinase acts as a tumor suppressor. Mutations of CHEK2 gene can lead to breast cancer, Li-Fraumeni syndrome, and other type cancers and diseases.

DESIGN


Primers for PCR

GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC


Our primers address the following design needs

  • Design specification 1 - explanation of how an aspect of the primers addresses any of the specifications in the "New System: Design Strategy" section
  • Design specification 2 - explanation of how an aspect of the primers addresses any of the specifications in the "New System: Design Strategy" section
  • Etc.




New System: Software

[THIS SECTION IS OPTIONAL. If your team has creative ideas for new software, and new software is a key component included in your new protocols, R&D, or machine design, you may describe it here. You will not receive bonus points, but a solid effort may raise your overall page layout points. If you decide not to propose new software, please delete this entire section, including the ==New System: Software== header.]



Personal tools