BME103 s2013:T900 Group4 L3: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 220: Line 220:
* '''PCR Protocol'''
* '''PCR Protocol'''
<!-- Create a step-by-step procedure for setting up and running PCR reactions. Your instructions should include everything from adding reagents to the tubes, to programming the PCR machine and running the reaction.-->
<!-- Create a step-by-step procedure for setting up and running PCR reactions. Your instructions should include everything from adding reagents to the tubes, to programming the PCR machine and running the reaction.-->
# Step 1: Obtain and label 8 50μL DNA samples (4 each from 2 patients, positive control, negative control) and 8 50μL tubes of PCR     reaction mix
# Obtain and label 8 50μL DNA samples (4 each from 2 patients, positive control, negative control) and 8 50μL tubes of PCR reaction mix
# Step 2: Set micropipette to 75μL and attach disposable tip
# Set micropipette to 75μL and attach disposable tip
# Step 3: Transfer all of the liquid from positive control DNA sample to a reaction mix tube, discard tip, label tube
# Transfer all of the liquid from positive control DNA sample to a reaction mix tube, discard tip, label tube
# Step 4: Repeat for the remaining 7 DNA samples
# Repeat for the remaining 7 DNA samples
# Step 5: Set the PCR program to run three stages
# Set the PCR program to run three stages
-1: 1 cycle, 95°C for 3 minutes
{| {{table}} width=700
-2: 35 cycles, 95°C for 30 seconds, 57°C for 30 seconds, 72°C for 30 seconds
|-
-3: 72°C for 3 minutes
| '''Stage''' ||  '''Number of Cycles''' || '''Temperature (°C)''' || Duration
-Final hold: 4°C
|-
| 1 || 1 || 95 || 3 minutes
|-
| 2 || 35 || 95 || 30 seconds
|-
|  ||  || 57 || 30 seconds
|-
| ||  || 72 || 30 seconds
|-
| 3 ||  || 72 || 3 minutes
|-
| Final hold ||  || 4
|}
 




Line 234: Line 247:
* '''DNA Measurement and Analysis Protocol'''
* '''DNA Measurement and Analysis Protocol'''
<!-- Create a step-by-step procedure for measuring DNA amplification in the PCR reactions. Your instructions should include everything from diluting the samples in SYBR Green, to placing the drops onto the fluorimeter (if your group is using the fluorimeter), to collecting and processing images in Image J. Don't forget to provide instructions on how to set up the calf thymus DNA samples for calibration, and how to convert INTDEN values into concentrations.--->
<!-- Create a step-by-step procedure for measuring DNA amplification in the PCR reactions. Your instructions should include everything from diluting the samples in SYBR Green, to placing the drops onto the fluorimeter (if your group is using the fluorimeter), to collecting and processing images in Image J. Don't forget to provide instructions on how to set up the calf thymus DNA samples for calibration, and how to convert INTDEN values into concentrations.--->
# Step 1: Obtain a tray of sample tubes (8 buffer, 2 SYBR GREEN, 1 H<sub>2</sub>O, 5 calf Thymus DNA, 8 PCR reaction samples)
# Obtain a tray of sample tubes (8 buffer, 2 SYBR GREEN, 1 H<sub>2</sub>O, 5 calf Thymus DNA, 8 PCR reaction samples)
# Step 2: Set micropipette to 120μL and attach disposable tip
# Set micropipette to 120μL and attach disposable tip
# Step 3: Transfer all of the liquid from positive control PCR sample to a buffer tube, discard tip, label tube
# Transfer all of the liquid from positive control PCR sample to a buffer tube, discard tip, label tube
# Step 4: Repeat for the remaining 7 PCR samples
# Step 4: Repeat for the remaining 7 PCR samples
# Step 5: Take a picture of the experiment  
# Step 5: Take a picture of the experiment  

Revision as of 03:26, 16 April 2013

BME 103 Spring 2013 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Kinjal Ahir Role:Protocol
Name: Zach Young
Initial Machine Testing
Name: Anna Essex
Initial Machine Testing
Name: Tuan Phan
Research and Design
Name: Amelia Lax
Research and Design

LAB 3 WRITE-UP

Original System: PCR Results

PCR Test Results

Sample Name Ave. INTDEN* Calculated (μg/mL) Conclusion (pos/neg)
Positive Control 1,450,385 1.60 pos
Negative Control 488,789 0.18 neg
Tube Label: B2 Patient ID: 17818 rep 1 709,603 0.51 pos
Tube Label: C2 Patient ID: 17818 rep 2 642,405 0.41 pos
Tube Label: D2 Patient ID: 17818 rep 3 417,721 0.07 neg
Tube Label: B1 Patient ID: 85158 rep 1 450,174 0.12 neg
Tube Label: C1 Patient ID: 85158 rep 2 387,850 0.03 neg
Tube Label: D1 Patient ID: 85158 rep 3 376,360 0.01 neg

* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images


Bayesian Statistics
These following conditional statistics are based upon all of the DNA detection system results that were obtained in the PCR lab for 20 hypothetical patients who were diagnosed as either having cancer or not having cancer.

Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B)


Calculation 1: The probability that the sample actually has the cancer DNA sequence, given a positive diagnostic signal.

  • A = frequency of cancer-positive conclusions = 9 / 20 = 0.45
  • B = frequency of positive PCR reactions = 26 / 60 = 0.43
  • P (B|A) = frequency of positive PCR given cancer-positive conclusion = 24 / 26 = 0.92
  • P(A|B) = 0.96 = 96%



Calculation 2: The probability that the sample actually has a non-cancer DNA sequence, given a negative diagnostic signal.

  • A = frequency of cancer-negative conclusions = 11 / 20 = 0.55
  • B = frequency of negative PCR reactions = 34 / 60 = 0.57
  • P (B|A) = frequency of negative PCR given cancer-negative conclusion = 31 / 34 = 0.91
  • P(A|B) = 0.88 = 88%


Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.

  • A = frequency of "yes" cancer diagnosis = 9 / 20 = 0.45
  • B = frequency of "pos" test conclusion = 26 / 60 = 0.43
  • P (B|A) = frequency of pos given yes = 24 / 26 = 0.92
  • P(A|B) = 0.96 = 96%



Calculation 4: The probability that the patient will not develop cancer, given a non-cancer DNA sequence.

  • A = frequency of "no" cancer diagnosis = 11 / 20 = 0.55
  • B = frequency of "neg" test conclusion = 34 / 60 = 0.57
  • P (B|A) = frequency of neg given no = 31 / 34 = 0.91
  • P(A|B) = 0.88 = 88%


New System: Design Strategy

We concluded that a good system Must Have:

- easily determined results: The easier the results are to read accurately, the less likely a misdiagnosis in either direction. It is undesirable both to give a false negative, where a patient is not treated when care is needed, or to give a false positive, wasting time and resources on those who do not need them. This aspect is central to any diagnostic tool.

- Simple OpenPCR Software: Simplicity increases ease and efficiency in lab experiments and hopefully leads to faster diagnoses. It also makes troubleshooting easier should problems arise. The more straightforward the system, the more quickly users can learn to use the machine.

We concluded that we would Want a good system to have:

- Low cost: Currently an OpenPCR machine costs $599 and a Fluorimeter costs $300. An inexpensive material would help reduce cost and increase accessibility, since there is always a limited budget for new equipment. This would not only allow users to increase the amount of tests that can be run at the same time, but also boost sales, which is important for marketing any device.

- integrated camera: phone cameras are easily moveable and vary in size and quality, leading to differing results. Smartphone camera settings can be time consuming or nonexistent. Having a built-in camera increases cost, but it is worth it to increase speed and accuracy. Furthermore, the program is simpler because it does not have to adjust to different cameras and phone sizes and shapes vary enough to make building a cradle to fit them difficult.


We concluded that a good system Must Not Have:

- Troublesome USB Connectivity. USB connectivity should function well in order for OpenPCR machine to work.

- Casing = fire hazard. High temperature with PCR can be dangerous.



We concluded that a good system Should Avoid:

- Avoid slow amplification.

- Hard to adjust phone/ fluorimeter. The phone can be easily moved by accident, which requires readjustment between the phone and the fluorimeter.





New System: Machine/ Device Engineering

SYSTEM DESIGN


Current design of fluorimeter

Rather than drastically change a fairly-efficient PCR machine, we decided that the fluorimeter setup was more in need of modification. The only change to the PCR machine would be improved USB ports, but the fluorimeter would have a built-in camera to remove the complications of positioning a camera phone. The phone would still be used to run the machine, but it wouldn't directly take the pictures. This new camera would take the place of the current cradle and be at a fixed position in respects to the fluorimeter for most efficient photographing. Also, the slots on the board of the fluorimeter would be labeled to avoid confusion in the process of analysis.


KEY FEATURES

Fluorimeter - We chose to include these new features:

  • Integrated Camera - helps reduce inconsistency of photography and time-consuming difficulty of positioning
  • Labeled slots - reduces likelihood of error from misidentified photographs


PCR Machine - We chose keep these features the same as the original system:

  • Reliable Hardware - the machine is sturdy and does its job efficiently considering its simple construction
  • Preexisting Software - the current Open PCR software is well developed and user-friendly


INSTRUCTIONS

  • Step 1: Connect the camera unit to the fluorimeter.
  • Step 2: Adjust the camera settings according to the current experiment.
  • Step 3: Link the camera to the phone being used to control the experiment.
  • Step 4: Take photo.
  • Step 5: Upload photo for necessary manipulation.


New System: Protocols

DESIGN
We chose to modify the hardware of the fluorimeter. However, overall protocols should remain the same. As the PCR machine was not modified, its protocols will also remain unaltered.

MATERIALS

Supplied in the Kit Amount
Camera Unit 1
Reaction mix 400μL
Battery 1
Software freeware
Supplied by the User Amount
Filter water 1,000μL
SYBR Green 2,000μL
Primers 4,000μL
DNA sample (negative and positive) 400μL


PROTOCOLS

  • PCR Protocol
  1. Obtain and label 8 50μL DNA samples (4 each from 2 patients, positive control, negative control) and 8 50μL tubes of PCR reaction mix
  2. Set micropipette to 75μL and attach disposable tip
  3. Transfer all of the liquid from positive control DNA sample to a reaction mix tube, discard tip, label tube
  4. Repeat for the remaining 7 DNA samples
  5. Set the PCR program to run three stages
Stage Number of Cycles Temperature (°C) Duration
1 1 95 3 minutes
2 35 95 30 seconds
57 30 seconds
72 30 seconds
3 72 3 minutes
Final hold 4



  • DNA Measurement and Analysis Protocol
  1. Obtain a tray of sample tubes (8 buffer, 2 SYBR GREEN, 1 H2O, 5 calf Thymus DNA, 8 PCR reaction samples)
  2. Set micropipette to 120μL and attach disposable tip
  3. Transfer all of the liquid from positive control PCR sample to a buffer tube, discard tip, label tube
  4. Step 4: Repeat for the remaining 7 PCR samples
  5. Step 5: Take a picture of the experiment
  6. Step 6: Repeat this trial with different samples
  7. Step 7: Use Image J and make a circle around the drop.




New System: Research and Development

BACKGROUND


CHEK2 is a gene located at chromosome 22. It provides instructions for making protein call checkpoint kinase 2. The checkpoint kinase acts as a tumor suppressor. Mutations of CHEK2 gene can lead to breast cancer, Li-Fraumeni syndrome, and other type cancers and diseases.

DESIGN


Primers for PCR

GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC


Our primers address the following design needs

  • Design specification 1 - explanation of how an aspect of the primers addresses any of the specifications in the "New System: Design Strategy" section
  • Design specification 2 - explanation of how an aspect of the primers addresses any of the specifications in the "New System: Design Strategy" section
  • Etc.




New System: Software

[THIS SECTION IS OPTIONAL. If your team has creative ideas for new software, and new software is a key component included in your new protocols, R&D, or machine design, you may describe it here. You will not receive bonus points, but a solid effort may raise your overall page layout points. If you decide not to propose new software, please delete this entire section, including the ==New System: Software== header.]