BME103 s2013:T900 Group4 L3
BME 103 Spring 2013 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 3 WRITE-UPOriginal System: PCR ResultsPCR Test Results
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.
New System: Design StrategyWe concluded that a good system Must Have: - easily determined results: The easier the results are to read accurately, the less likely a misdiagnosis in either direction. It is undesirable both to give a false negative, where a patient is not treated when care is needed, or to give a false positive, wasting time and resources on those who do not need them. This aspect is central to any diagnostic tool. - Simple OpenPCR Software: Simplicity increases ease and efficiency in lab experiments and hopefully leads to faster diagnoses. It also makes troubleshooting easier should problems arise. The more straightforward the system, the more quickly users can learn to use the machine. We concluded that we would Want a good system to have: - Low cost: Currently an OpenPCR machine costs $599 and a Fluorimeter costs $300. An inexpensive material would help reduce cost and increase accessibility, since there is always a limited budget for new equipment. This would not only allow users to increase the amount of tests that can be run at the same time, but also boost sales, which is important for marketing any device. - integrated camera: phone cameras are easily moveable and vary in size and quality, leading to differing results. Smartphone camera settings can be time consuming or nonexistent. Having a built-in camera increases cost, but it is worth it to increase speed and accuracy. Furthermore, the program is simpler because it does not have to adjust to different cameras and phone sizes and shapes vary enough to make building a cradle to fit them difficult.
- Troublesome USB Connectivity. USB connectivity should function well in order for OpenPCR machine to work. - Casing = fire hazard. High temperature with PCR can be dangerous.
We concluded that a good system Should Avoid: - Avoid slow amplification. - Hard to adjust phone/ fluorimeter. The phone can be easily moved by accident, which requires readjustment between the phone and the fluorimeter.
New System: Machine/ Device EngineeringSYSTEM DESIGN
Fluorimeter - We chose to include these new features:
PCR Machine - We chose keep these features the same as the original system:
New System: ProtocolsDESIGN
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Stage | Number of Cycles | Temperature (°C) | Duration | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 | 1 | 95 | 3 minutes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2 | 35 | 95 | 30 seconds | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
n/a | 57 | 30 seconds | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
n/a | 72 | 30 seconds | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3 | n/a | 72 | 3 minutes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Final hold | n/a | 4 | n/a |
- Load the mixed tubes into the PCR machine, close the lid, run the program
- Remove tubes at end of program
- DNA Measurement and Analysis Protocol
- Obtain a tray of sample tubes (8 buffer, 2 SYBR GREEN, 1 H2O, 5 calf Thymus DNA, 8 PCR reaction samples)
- Set micropipette to 120μL and attach disposable tip
- Transfer all of the liquid from positive control PCR sample to a buffer tube, discard tip, label tube
- Repeat for the remaining 7 PCR samples
- Calibrate the fluorimeter using the calf thymus DNA samples of known concentration
- Set up the integrated camera and adjust the settings, connect the smartphone to the camera for control
- Place 80μL of SYBR GREEN I onto the slide so it forms a definite drop, add 80μL of DNA, align with the LED
- Cover the fluorimeter with the light box and use phone to take picture
- Remove the box, remove the drop, export picture to computer for analysis (Make sure to label!)
- In ImageJ, adjust the settings and split the color channels of the image to select green
- Draw an oval around the image and measure, repeat for background
- Repeat for the remaining concentrations of calf thymus DNA
- Use these readings and the known DNA concentrations to create a graph with a linear fit for calculating concentration based on INTDEN values
- Using the same procedure, repeat with the unknown DNA samples from the patients and use the graph to calculate DNA concentration
New System: Research and Development
BACKGROUND
CHEK2 is a gene located at chromosome 22. It provides instructions for making protein call checkpoint kinase 2. The checkpoint kinase acts as a tumor suppressor. Mutations of CHEK2 gene can lead to breast cancer, Li-Fraumeni syndrome, and other type cancers and diseases.
DESIGN
Primers for PCR
GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC
Our primers address the following design needs
- Design specification 1 - explanation of how an aspect of the primers addresses any of the specifications in the "New System: Design Strategy" section
- Design specification 2 - explanation of how an aspect of the primers addresses any of the specifications in the "New System: Design Strategy" section
- Etc.
New System: Software
[THIS SECTION IS OPTIONAL. If your team has creative ideas for new software, and new software is a key component included in your new protocols, R&D, or machine design, you may describe it here. You will not receive bonus points, but a solid effort may raise your overall page layout points. If you decide not to propose new software, please delete this entire section, including the ==New System: Software== header.]