BME103 s2013:T900 Group5 L3: Difference between revisions
Line 91: | Line 91: | ||
<!--The whole team is responsible for completing this section. This is where you get to express/ argue why certain aspects fall under Must Have, Want, Must Not Have, or Should Avoid. List the two aspects that your team picked from each category in class. You are allowed to create new aspects, as long as they are relevant to your new design.--> | <!--The whole team is responsible for completing this section. This is where you get to express/ argue why certain aspects fall under Must Have, Want, Must Not Have, or Should Avoid. List the two aspects that your team picked from each category in class. You are allowed to create new aspects, as long as they are relevant to your new design.--> | ||
''We concluded that a good system to "Must Have: | ''We concluded that a good system to "Must Have:"" | ||
* Results that are easy to determine. This means a clear indication of positive or negative results when compared to the controls. This is integral to the design success because the results must be easy differentiable as to not require re-testing. | * Results that are easy to determine. This means a clear indication of positive or negative results when compared to the controls. This is integral to the design success because the results must be easy differentiable as to not require re-testing. | ||
* Software that is simple to use. The software for open PCR is incredibly easy to use and a program similar would be ideal. Anything that requires computer coding or computational design is too complicated, so the software must already be made to use. A user should be able to plug in the information he or she wants and get the desired response from the software, no computing needed. | * Software that is simple to use. The software for open PCR is incredibly easy to use and a program similar would be ideal. Anything that requires computer coding or computational design is too complicated, so the software must already be made to use. A user should be able to plug in the information he or she wants and get the desired response from the software, no computing needed. |
Revision as of 01:15, 16 April 2013
BME 103 Spring 2013 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 3 WRITE-UPOriginal System: PCR ResultsPCR Test Results
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Bayes Theorem is an equation in probability theory and statistics that relates inverse representations of probabilities concerning two events, or rather, it expresses a degree of change when accounting for evidence. Bayes Theorem is represented as follows: P(A|B) = P(B|A) * P(A) / P(B) Which can be read as the probability of A given B = (the probability of B given A * the probability of A) / the probability of B This information will be utilized to determine various probabilities listed below when accounting for the positive/negative values determined by the entire class as well as an outside document listing the actual yes/no cancer diagnosis
New System: Design StrategyWe concluded that a good system to "Must Have:""
We concluded that a good system Should Avoid:
New System: Machine/ Device EngineeringSYSTEM DESIGN
KEY FEATURES We chose to include these new features
[OR] We chose keep the devices the same as the original system
INSTRUCTIONS
New System: ProtocolsDESIGN We chose to include these new approaches/ features
[OR] We chose keep the protocols the same as the original system
PROTOCOLS
New System: Research and DevelopmentBACKGROUND Polymerase chain reaction is the process of amplifying a strand of DNA from a DNA template strand. From here the scientist is capable of amplifying any specific gene they choose. In this research we are targeting the single nucleotide polymorphism that is rs1787996, which contains a single nucleotide variation or SNV. The CHEK2 gene is essentially a gene that is capable of coding for susceptibility to breast cancer. The relation to SNP is that it is essentially a variation of the CHEK 2 gene that is present within humans, or Homo sapiens. The cancer-related function of the gene is that it essentially changes the base Thymine to Cytosine, changing the normal allele ATT to ACT, which is the cancer related allele.
Primers for PCR Cancer allele forward primer: 5' TATGTATGCACTGTAAGAGTT Cancer allele reverse prime: 5' CTAGGAGAGCTGGTAATTTGG A disease allele will give a PCR product because the primer associated with the process will identify the sequences that will code for cancer. From there the primer will allow for nucleotide bases to be placed in a reverse sequence from the template DNA. Essentially this will continuously amplify the cancerous DNA gene while the PCR process is in effect.
New System: Software[THIS SECTION IS OPTIONAL. If your team has creative ideas for new software, and new software is a key component included in your new protocols, R&D, or machine design, you may describe it here. You will not receive bonus points, but a solid effort may raise your overall page layout points. If you decide not to propose new software, please delete this entire section, including the ==New System: Software== header.]
|