BME103 s2013:T900 Group5 L3: Difference between revisions
Line 119: | Line 119: | ||
http://i47.tinypic.com/65tt9e.jpg | http://i47.tinypic.com/65tt9e.jpg | ||
Our PCR will be powered by a removable battery that will be power by the energy provided by the sun. The solar power PCR will be not only be energy efficient, but it will also be cheaper to run, and more accessible. Using this solar power system will also give the PCR more power to run and ultimately give the new PCR more accurate and faster results. | <br>Our PCR will be powered by a removable battery that will be power by the energy provided by the sun. The solar power PCR will be not only be energy efficient, but it will also be cheaper to run, and more accessible. Using this solar power system will also give the PCR more power to run and ultimately give the new PCR more accurate and faster results. | ||
'''KEY FEATURES'''<br> | '''KEY FEATURES'''<br> | ||
<!-- If your team decided to change any of the machinery/ devices, summarize the new features here and delete the '''We chose keep the devices the same as the original system''' section. --> | <!-- If your team decided to change any of the machinery/ devices, summarize the new features here and delete the '''We chose keep the devices the same as the original system''' section. --> | ||
'''We chose to include these new features''' | '''We chose to include these new features''' | ||
* | * Solar Battery - A removable solar battery that can be placed in the sun for hours at a time to receive energy for the PCR. This solar powered battery will create 10x more energy than a normol plug outlet can provide making the PCR, making the timing for each cycle faster and and more time consistent. The new PCR system will also have a lesser price to its users and will not consume nearly as much energy. | ||
* Plug - A area inside the PCR where the solar powered battery can be placed to turn the PCR on | |||
* | |||
Revision as of 22:20, 16 April 2013
BME 103 Spring 2013 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 3 WRITE-UPOriginal System: PCR ResultsPCR Test Results
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Bayes Theorem is an equation in probability theory and statistics that relates inverse representations of probabilities concerning two events, or rather, it expresses a degree of change when accounting for evidence. Bayes Theorem is represented as follows: P(A|B) = P(B|A) * P(A) / P(B) Which can be read as the probability of A given B = (the probability of B given A * the probability of A) / the probability of B This information will be utilized to determine various probabilities listed below when accounting for the positive/negative values determined by the entire class as well as an outside document listing the actual yes/no cancer diagnosis
New System: Design StrategyWe concluded that a good system "Must Have":
We concluded that a good system Should Avoid:
New System: Machine/ Device EngineeringRather than consuming loads amount of energy with the PCR's technology, our new PCR will be solar battery powered. SYSTEM DESIGN http://i47.tinypic.com/65tt9e.jpg
We chose to include these new features
INSTRUCTIONS
New System: ProtocolsDESIGN We chose to include these new approaches/ features
[OR] We chose keep the protocols the same as the original system
PROTOCOLS
New System: Research and DevelopmentBACKGROUND Polymerase chain reaction is the process of amplifying a strand of DNA from a DNA template strand. From here the scientist is capable of amplifying any specific gene they choose. In this research we are targeting the single nucleotide polymorphism that is rs1787996, which contains a single nucleotide variation or SNV. The CHEK2 gene is essentially a gene that is capable of coding for susceptibility to breast cancer. The relation to SNP is that it is essentially a variation of the CHEK 2 gene that is present within humans, or Homo sapiens. The cancer-related function of the gene is that it essentially changes the base Thymine to Cytosine, changing the normal allele ATT to ACT, which is the cancer related allele.
Primers for PCR Cancer allele forward primer: 5' TATGTATGCACTGTAAGAGTT Cancer allele reverse prime: 5' CTAGGAGAGCTGGTAATTTGG A disease allele will give a PCR product because the primer associated with the process will identify the sequences that will code for cancer. From there the primer will allow for nucleotide bases to be placed in a reverse sequence from the template DNA. Essentially this will continuously amplify the cancerous DNA gene while the PCR process is in effect.
New System: Software[THIS SECTION IS OPTIONAL. If your team has creative ideas for new software, and new software is a key component included in your new protocols, R&D, or machine design, you may describe it here. You will not receive bonus points, but a solid effort may raise your overall page layout points. If you decide not to propose new software, please delete this entire section, including the ==New System: Software== header.]
|