BME103 s2013:T900 Group8 L3: Difference between revisions
(36 intermediate revisions by 5 users not shown) | |||
Line 14: | Line 14: | ||
|- valign="top" | |- valign="top" | ||
| [[Image:BME103student.jpg|100px|thumb|Name: Anthony Zingale<br>Role:Experimental Protocol Planner]] | | [[Image:BME103student.jpg|100px|thumb|Name: Anthony Zingale<br>Role:Experimental Protocol Planner]] | ||
| [[Image: | | [[Image:ASU_BME 2013 group 8 chem cat prof.jpg|200px|thumb|Name: Josh Snyder<br>Role:Machine Tester]] | ||
| [[Image: | | [[Image:BME103 Group8 PAK.jpg.jpg|200px|thumb|Name: Adam Pak<br>Role: Experimental Protocol Planner]] | ||
| [[Image:BME103student.jpg|100px|thumb|Name: Sunshine Silvas<br>Role:Machine Tester]] | | [[Image:BME103student.jpg|100px|thumb|Name: Sunshine Silvas<br>Role:Machine Tester]] | ||
| [[Image: | | [[Image:ew.png|100px|thumb|Name: Renee Tran<br>Role:Research and Development scientist ]] | ||
|} | |} | ||
Line 30: | Line 30: | ||
| Sample Name || Ave. INTDEN* || Calculated μg/mL || Conclusion (pos/neg) | | Sample Name || Ave. INTDEN* || Calculated μg/mL || Conclusion (pos/neg) | ||
|- | |- | ||
| Positive Control || | | Positive Control (+) || || --- || N/A | ||
|- | |- | ||
| Negative Control || | | Negative Control (-) || || ---|| N/A | ||
|- | |- | ||
| Tube Label: | | Tube Label:1-A Patient ID: 57483 rep 1 || 1.81E+03 || --- || neg | ||
|- | |- | ||
| Tube Label: | | Tube Label:1-B Patient ID: 57483 rep 2 || 1.82E+05 || --- || neg | ||
|- | |- | ||
| Tube Label: | | Tube Label:1-C Patient ID: 57483 rep 3 || 6.32E+05 || --- || neg | ||
|- | |- | ||
| Tube Label: | | Tube Label:2-A Patient ID: 80175 rep 1 || 2.34E+06|| --- || pos | ||
|- | |- | ||
| Tube Label: | | Tube Label:2-B Patient ID: 80175 rep 2 || 4.57E+06 || --- || pos | ||
|- | |- | ||
| Tube Label: | | Tube Label:2-C Patient ID: 80175 rep 3 || 4.49E+06|| --- || pos | ||
|} | |} | ||
<nowiki>* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images</nowiki> | <nowiki>* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images</nowiki> | ||
Line 56: | Line 56: | ||
Calculation 1: The probability that the sample actually has the cancer DNA sequence, given a positive diagnostic signal.<br> | Calculation 1: The probability that the sample actually has the cancer DNA sequence, given a positive diagnostic signal.<br> | ||
* A = | * A = P of positive conclusion = 9 / 20 = 0.45 | ||
* B = | * B = P of positive PCR reaction = 26 / 60 = 0.43 | ||
* P (B|A) = | * P (B|A) = P of positive signal, given cancer-positive conclusion = 21 / 24 = 0.875 | ||
* '''P(A|B) = | * '''P(A|B) = 0.92 = 92%''' | ||
<br> | |||
This means that if there is one positive diagnostic signal, there is a probability of .92 that the test conclusion will be positive | |||
<br><br> | |||
Calculation 2: The probability that the sample has a non-cancer DNA sequence, given a negative diagnostic signal.<br> | |||
* A = P of negative conclusion = 11/20 = .55 | |||
* B = P of negative PCR reaction = 34/60 = .567 | |||
* P (B|A) = P of Negative PCR reaction, given cancer-negative conclusion = 29/31 = .935 | |||
* '''P(A|B) = .907 = 91%''' | |||
< | This means that if there is one negative diagnostic signal, there is a probability of .91 that the test conclusion will be negative | ||
Calculation | <br><br> | ||
* A = | Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence (positive conclusion).<br> | ||
* B = | * A = P of positive cancer diagnosis = 7/20 = .35 | ||
* P (B|A) = | * B = P of positive conclusion = 9/20 = .45 | ||
* '''P(A|B) = | * P (B|A) = P of positive conclusion, given positive cancer diagnosis = 6/7 = .857 | ||
* '''P(A|B) = .667 = 67%''' | |||
Calculation | This means that if a test concludes in a positive signal, the probability of the patient developing cancer is .67 | ||
* A = | <br><br> | ||
* B = | Calculation 4: The probability that the patient will not develop cancer, given a non-cancer DNA sequence (negative conclusion).<br> | ||
* P (B|A) = | * A = P of negative cancer diagnosis = 13/20 = .65 | ||
* '''P(A|B) = | * B = P of negative conclusion = 11/20 = .55 | ||
* P (B|A) = P of negative conclusion, given negative cancer diagnosis = 10/13 = .769 | |||
* '''P(A|B) = .909 = 91%''' | |||
This means that if a test concludes in a negative signal, the probability of the patient not developing cancer is .91. | |||
<br> | <br> | ||
Neither resulting probability is especially encouraging as treatment for a life threatening disease may rely on this data. | |||
Calculation 3 represents cancer growth probability based on a positive conclusion and 1 minus Calc 3, 1-.67 = .33 is the | |||
probability of a false positive. Calculation 4 represents no cancer growth probability based on a negative conclusion and 1 minus | |||
Calc 4, 1-.91 = .09 is the probability of a false negative. This means that roughly 9 patients out of every 100 will be given a | |||
negative conclusion yet will still develop cancer. This could be due to other factors such as starting to develop cancer after | |||
the DNA was taken for the PCR test. A second or third test would have to be run automatically independent of the results in | |||
order to make sure that an incorrect conclusion is not reached. | |||
<br><br> | |||
==New System: Design Strategy== | ==New System: Design Strategy== | ||
Line 90: | Line 102: | ||
'''We concluded that a good system ''Must Have'':''' | '''We concluded that a good system ''Must Have'':''' | ||
* [Must have #1 - A "must have" for our new devise is having the results be easy to determine. The reason for this would be that it would allow for more users of the devise and give them a simple to use product. We did not want to complicate the system and thus leading to users not wanting to use the product, our goal is to simplify the PCR machine to be more user friendly.] | * [Must have #1 - A "must have" for our new devise is having the results be easy to determine. The reason for this would be that it would allow for more users of the devise and give them a simple to use product. We did not want to complicate the system and thus leading to users not wanting to use the product, our goal is to simplify the PCR machine to be more user friendly.] | ||
* [Must have #2 - | * [Must have #2 - A "must have" for our new device is easily replaceable parts. The reason for this would be that it can allow a wider range or people to use the product because if the parts are easier to replace then it will drop the price of the device. It will also allow for quick and easy repairs, that can save time and prevent results from being delayed. | ||
'''We concluded that we would ''Want'' a good system to have:''' | '''We concluded that we would ''Want'' a good system to have:''' | ||
* [Want #1 - Something that we wanted to include in our new design is to keep it portable and compact. When thinking about who would use the machine and where, there were many different situations that came up. Although the machine will be used in a lab or an office it will be able to take it other place without having to worry about weather the devise can with stand the situations it is in. This feature also is helpful because when storing the machine it is not very difficult but simply and easy.] | * [Want #1 - Something that we wanted to include in our new design is to keep it portable and compact. When thinking about who would use the machine and where, there were many different situations that came up. Although the machine will be used in a lab or an office it will be able to take it other place without having to worry about weather the devise can with stand the situations it is in. This feature also is helpful because when storing the machine it is not very difficult but simply and easy.] | ||
* [Want #2 - why | * [Want #2 - Another thing that we wanted was for the PCR machine to be durable. The reason why we would want the device to be durable is because of the fact that it would take off the stress of breaking the machine. Humans will make mistakes so the more durable it is the less of an impact those mistakes will have. | ||
'''We concluded that a good system ''Must Not Have'':''' | '''We concluded that a good system ''Must Not Have'':''' | ||
* [Must Not Have #1 - One of the most important factors we want to change is the troublesome USB connection between the PRC Machine and the computer. This fault causes difficulty when trying to connect the machines information and the computer system that analyzes it. If this was to be fixed it would then lead to more accurate and reliable results. ] | * [Must Not Have #1 - One of the most important factors we want to change is the troublesome USB connection between the PRC Machine and the computer. This fault causes difficulty when trying to connect the machines information and the computer system that analyzes it. If this was to be fixed it would then lead to more accurate and reliable results. ] | ||
* [Must Not Have #2 - | * [Must Not Have #2 - It is important that the machine does not have any complicated instructions on how to handle and use the device. If the device is so complicated that it takes lots of time to understand how to use then it defeats the purpose of having the device in the first place. | ||
'''We concluded that a good system ''Should Avoid'':''' | '''We concluded that a good system ''Should Avoid'':''' | ||
* [Should Avoid #1 - Since we are wanting the machine to be compact and portable, something we should avoid is how the energy consumption. If we have an inefficient power source or one that need direct connection that then makes the portability an un-needed feature. If we could find an outside source of power the could last an appropriate amount of time that would compliment thee portability feature and make our new design even better.] | * [Should Avoid #1 - Since we are wanting the machine to be compact and portable, something we should avoid is how the energy consumption. If we have an inefficient power source or one that need direct connection that then makes the portability an un-needed feature. If we could find an outside source of power the could last an appropriate amount of time that would compliment thee portability feature and make our new design even better.] | ||
* [Should Avoid #2 - | * [Should Avoid #2 - Since we are wanting a durable machine we should avoid using non-reliable parts. This is important because of the fact that if the parts only a few trials and then need to be replaced. The device needs to be able to repeat the same results over and not have any strain on the devices. If we are able to have a device that is constant then we will have a marketable device. | ||
Line 115: | Line 124: | ||
'''SYSTEM DESIGN'''<br> | '''SYSTEM DESIGN'''<br> | ||
[[Image:ASU BME 103 group 8 highlighted PCR.jpg|100px]] | |||
<br> | |||
The primary modification from the first OpenPCR machine will be the USB connection. In order to ensure a better connection, a more durable cable with rubber around the leads, similar to the one pictured below will be implemented. This includes adjusting the port on the PCR machine itself in order to make the new cable fit. | |||
<br><br> | |||
[[Image:ASUBME103 group 8 PCR plug.jpg|50px]] | |||
<br><br> | |||
<!-- If your design goals include modifying the Open PCR machine, include an image or images from the Open PCR Solid Works 3D rendering exercise. Write a short paragraph that summarizes what your team is going to modify --> | <!-- If your design goals include modifying the Open PCR machine, include an image or images from the Open PCR Solid Works 3D rendering exercise. Write a short paragraph that summarizes what your team is going to modify --> | ||
<!-- If your goal includes modifying the Fluorimeter, include a labeled image or images of the Fluorimeter. There is no Solid Works file for the Fluorimeter. Write a short paragraph that summarizes what your team is going to modify --> | <!-- If your goal includes modifying the Fluorimeter, include a labeled image or images of the Fluorimeter. There is no Solid Works file for the Fluorimeter. Write a short paragraph that summarizes what your team is going to modify --> | ||
Line 127: | Line 141: | ||
* Feature 1 - Under the "must not have" section we are addressing the troublesome USB connection. The way we are going to address this problem by one of two ways. One way is to encase the metal tip of the cord with plastic that would have a better grip and not fall off as easily. Along with this, by have a indention on the machine where the USB would sit snug will help the connection be more stable and reliable. As a second idea to address this problem would be to add a safety lock feature on the cord. That would also increase the stability and the connection of the cord. | * Feature 1 - Under the "must not have" section we are addressing the troublesome USB connection. The way we are going to address this problem by one of two ways. One way is to encase the metal tip of the cord with plastic that would have a better grip and not fall off as easily. Along with this, by have a indention on the machine where the USB would sit snug will help the connection be more stable and reliable. As a second idea to address this problem would be to add a safety lock feature on the cord. That would also increase the stability and the connection of the cord. | ||
* Feature 2 - explanation of how this addresses any of the specifications in the "New System: Design Strategy" section | * Feature 2 - explanation of how this addresses any of the specifications in the "New System: Design Strategy" section | ||
'''INSTRUCTIONS''' <br> | '''INSTRUCTIONS''' <br> | ||
Instructions for the new machine do not need to be altered as the new cable and connection serves the same purpose and are used in the same way as the previous version. | |||
<!-- Changing the machine will require new instructions for using the machine. Write a short step-by-step list of instructions on how to set up and use the new machine. The instructions must be specific to your new design. --> | <!-- Changing the machine will require new instructions for using the machine. Write a short step-by-step list of instructions on how to set up and use the new machine. The instructions must be specific to your new design. --> | ||
<!-- If your team decided not to change any of the machinery/ devices, write a short step-by-step list of instructions on how to set up and use each machine. You may want to consider modifying the instructions to improve ease of use. --> | <!-- If your team decided not to change any of the machinery/ devices, write a short step-by-step list of instructions on how to set up and use each machine. You may want to consider modifying the instructions to improve ease of use. --> | ||
Line 145: | Line 161: | ||
<!-- If your team decided to change the PCR and/or the Fluorimeter imaging protocols, summarize the new approaches/ features here and delete the '''We chose keep the protocols the same as the original system''' section. --> | <!-- If your team decided to change the PCR and/or the Fluorimeter imaging protocols, summarize the new approaches/ features here and delete the '''We chose keep the protocols the same as the original system''' section. --> | ||
'''We chose to include these new approaches/ features''' | '''We chose to include these new approaches/ features''' | ||
* Feature 1 - | * Feature 1 = use one more positive and one more negative control - <br> | ||
* Feature 2 - | Part of our problems were that on the very end when all the results were collected from all the groups that were involved in this BME is that we were not 100% on the results on each patient. Also we had trouble matching numbers with positive and negative results. to increase the accuracy of our results it would be good to place tow more tubes into the PCR machine that can serve as extra controls. | ||
* Feature 2 = improving Fluorimeter imaging standards - <br> | |||
each group in the BME lab have used different smart phone, which means different types of cameras were used. each of those cameras have setting on that can not be changed. i think standarizing and raising the the cameras in the class would greatly improve the confidence that our results are correct. | |||
'''Standard Application''' | |||
Reagents supplied by the user : | Reagents supplied by the user : | ||
Line 207: | Line 215: | ||
3.place two rows of four tubes into PCR that were prepared before, using PC click start and <br> | 3.place two rows of four tubes into PCR that were prepared before, using PC click start and <br> | ||
allow time for the tests to take place leaving the PCR in a controlled environmental | allow time for the tests to take place leaving the PCR in a controlled environmental | ||
<br> | |||
<br> | |||
'''Using SYBR Green Dye''' | '''Using SYBR Green Dye''' | ||
<br> | <br> | ||
Line 239: | Line 248: | ||
| 6 || 5.0 micrograms per ml | | 6 || 5.0 micrograms per ml | ||
|} | |} | ||
3.take each sample and place one drop on perforated and hydro-phobic glass. calibrate the camera and then <br> | |||
set the camera on its stance. take careful notes of the set up and the distances that the camera is from the sample <br> | |||
, the height of the camera... etc. close the dark box to block out all the outside light and take a picture. <br> | |||
repeat this process for all 6 samples. | |||
<!--- Place your two tables "Supplied in the kit" and "Supplied by User" here ---> | <!--- Place your two tables "Supplied in the kit" and "Supplied by User" here ---> | ||
'''Materials summery''' | |||
{| {{table}} width=700 | |||
''' | |-style="background:#f0f0f0;" | ||
| Supplied in the kit|| Supplied by User | |||
|- | |||
| | |||
*Water | |||
*pipette | |||
*Superhydrophobic surface | |||
*cradle | |||
*Smart phone | |||
* | *Box | ||
*plastic base | |||
*small box to set up the phone | |||
*software | |||
*PCR | |||
*Pipette and tips | |||
*two rows of empty test tubes | |||
|| | |||
*Water | |||
*Set of read SYBR green(5 samples) | |||
*master mix | |||
*Smartphone | |||
*A set of four dyes (blue, green, yellow, red) | |||
*Sample containing (+,-,P1,P1,P1,P2,P2,P2) | |||
|} | |||
==New System: Research and Development== | ==New System: Research and Development== | ||
Line 267: | Line 287: | ||
<!--- A description of the CHEK2 gene, it's associated SNP, and the cancer-related function of the gene. Use the information from your Week 13 worksheet. ---> | <!--- A description of the CHEK2 gene, it's associated SNP, and the cancer-related function of the gene. Use the information from your Week 13 worksheet. ---> | ||
"CHEK2" gene is short for: Checkpoint Kinase 2. For humans, or Homo sapiens, the DNA is made up of proteins that have specific coding in an A-T or G-C formatting. CHEK2 is a mutation that changes that normal allele pattern of "ATT" to "ACT". This mutation prevents control of the cell cycle regulators that ultimately prevent mitosis from occurring. This can lead to sarcomas, breast cancer, and brain tumors. | |||
'''DESIGN''' | '''DESIGN''' | ||
To amplify the cancer associated sequence a primer pair that has a change in the normal allele forward primer needs to be designed; the "cancer allele forward primer". Vice versa, thr "cancer allele reverse primer" will stay the same. | |||
'''Normal allele forward primer:'''CCCAGGATTTTTGAGAATGTA<br> | |||
'''Cancer allele reverse primer:'''GGGTCCTAAAAACTCTTACAT<br> | |||
'''Primers for PCR'''<br> | '''Primers for PCR'''<br> | ||
<!-- If your team decided to only amplify cancer-associated DNA, list the "Cancer allele forward primer" sequence and the "Cancer allele reverse primer" sequence. Include a paragraph that explains why a disease allele will give a PCR product and the non-disease allele will not.--> | <!-- If your team decided to only amplify cancer-associated DNA, list the "Cancer allele forward primer" sequence and the "Cancer allele reverse primer" sequence. Include a paragraph that explains why a disease allele will give a PCR product and the non-disease allele will not.--> | ||
'''Cancer allele forward primer:'''CCCAGGATTTTGAG'''ACT'''GTA<br> | |||
'''Cancer allele reverse primer:'''GGGTCCTAAAAACTCTTACAT<br> | |||
The cancerous gene will produce a positive result, while the non-cancer gene will give a negative result, because the primers are designed to amplify cancerous DNA. Therefore, the cancerous mutation cannot bind to normal DNA, ultimately meaning that amplification cannot occur.(http://openwetware.org/wiki/BME103_s2013:T900_Group8) | |||
<!-- If your team chose an alternative approach to amplify the DNA, list all relevant primers. Include a paragraph that explains how your system works.--> | <!-- If your team chose an alternative approach to amplify the DNA, list all relevant primers. Include a paragraph that explains how your system works.--> | ||
'''Our primers address the following design needs''' | '''Our primers address the following design needs''' | ||
* Design specification 1 - | * Design specification 1 - "Use one more positive and one more negative control" | ||
Design cancer positive primers with more than one mutation. Rather than just switching the "ATT" to "ACT", the primer can also switch out a larger stran like "TTTTTT" to "TATAT" | |||
* Design specification 2 - "Improving Fluorimeter imaging standards" | |||
With a primer that has more mutations,the positive results will amplify more, makes it easier to identify the green in the fluorimeter. | |||
<br><br> | <br><br> | ||
Latest revision as of 19:02, 16 April 2013
BME 103 Spring 2013 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 3 WRITE-UPOriginal System: PCR ResultsPCR Test Results
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B)
This means that if there is one positive diagnostic signal, there is a probability of .92 that the test conclusion will be positive
Calculation 2: The probability that the sample has a non-cancer DNA sequence, given a negative diagnostic signal.
This means that if there is one negative diagnostic signal, there is a probability of .91 that the test conclusion will be negative
This means that if a test concludes in a positive signal, the probability of the patient developing cancer is .67
This means that if a test concludes in a negative signal, the probability of the patient not developing cancer is .91.
New System: Design StrategyWe concluded that a good system Must Have:
We concluded that we would Want a good system to have:
We concluded that a good system Must Not Have:
We concluded that a good system Should Avoid:
New System: Machine/ Device EngineeringSYSTEM DESIGN
We chose to include these new features
INSTRUCTIONS Instructions for the new machine do not need to be altered as the new cable and connection serves the same purpose and are used in the same way as the previous version.
New System: ProtocolsDESIGN We chose to include these new approaches/ features
Part of our problems were that on the very end when all the results were collected from all the groups that were involved in this BME is that we were not 100% on the results on each patient. Also we had trouble matching numbers with positive and negative results. to increase the accuracy of our results it would be good to place tow more tubes into the PCR machine that can serve as extra controls.
each group in the BME lab have used different smart phone, which means different types of cameras were used. each of those cameras have setting on that can not be changed. i think standarizing and raising the the cameras in the class would greatly improve the confidence that our results are correct.
Reagents supplied by the user :
3.Sample mixed should contain sample of two patient each containg 3 replicates. As well as
3.place two rows of four tubes into PCR that were prepared before, using PC click start and
3.take each sample and place one drop on perforated and hydro-phobic glass. calibrate the camera and then
New System: Research and DevelopmentBACKGROUND
To amplify the cancer associated sequence a primer pair that has a change in the normal allele forward primer needs to be designed; the "cancer allele forward primer". Vice versa, thr "cancer allele reverse primer" will stay the same. Normal allele forward primer:CCCAGGATTTTTGAGAATGTA
Cancer allele forward primer:CCCAGGATTTTGAGACTGTA The cancerous gene will produce a positive result, while the non-cancer gene will give a negative result, because the primers are designed to amplify cancerous DNA. Therefore, the cancerous mutation cannot bind to normal DNA, ultimately meaning that amplification cannot occur.(http://openwetware.org/wiki/BME103_s2013:T900_Group8)
Design cancer positive primers with more than one mutation. Rather than just switching the "ATT" to "ACT", the primer can also switch out a larger stran like "TTTTTT" to "TATAT"
With a primer that has more mutations,the positive results will amplify more, makes it easier to identify the green in the fluorimeter.
|