BME103 s2013:T900 Group9 L3: Difference between revisions
Brady Falk (talk | contribs) |
Brady Falk (talk | contribs) |
||
Line 123: | Line 123: | ||
[[Image:PCR.jpg|400px|]]<br> | [[Image:PCR.jpg|400px|]]<br> | ||
''Photo of Open PCR Machine''<br> <br> | ''Photo of Open PCR Machine.''<br> <br> | ||
The only thing that will be changed in the Open PCR design is the type of materials that will be used. It was found that the results of the lab came back accurate, giving no reason for the design of the machine to be changed. The only changes will be because of safety concerns. The Open PCR Machine has an exterior made of thin plywood, easily able to catch on fire with the high temperatures that it is dealing with. The new design will have an exterior made of metal, making sure that no fire hazards exist. The purpose of the Open PCR machine is to send DNA samples through cycles of heating up and cooling down, priming them to be analyzed by the Fluorimeter device.<br> | The only thing that will be changed in the Open PCR design is the type of materials that will be used. It was found that the results of the lab came back accurate, giving no reason for the design of the machine to be changed. The only changes will be because of safety concerns. The Open PCR Machine has an exterior made of thin plywood, easily able to catch on fire with the high temperatures that it is dealing with. The new design will have an exterior made of metal, making sure that no fire hazards exist. The purpose of the Open PCR machine is to send DNA samples through cycles of heating up and cooling down, priming them to be analyzed by the Fluorimeter device.<br> | ||
Revision as of 21:52, 15 April 2013
BME 103 Spring 2013 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 3 WRITE-UPOriginal System: PCR ResultsPCR Test Results
* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images
Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B)
Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.
New System: Design StrategyWe concluded that a good system Must Have:
New System: Machine/ Device EngineeringSYSTEM DESIGN The only thing chaged in our design is the type of material used. Our materials will be changed to be cheaper, and to provide for a safer machine. Photo of the Single-Drop Fluorimeter Device.
KEY FEATURES
New System: ProtocolsDESIGN We chose to include these new approaches/ features
Heated Lid: 110°C Initial Step: temp: 95°C time: 180 sec Number of Cycles: 35 Denaturing: temp: 95°C time: 30 sec Annealing: temp: 57°C time: 30 sec Extending: temp: 72°C time: 30 sec Final Hold: temp: 4°C
New System: Research and DevelopmentBACKGROUND CHEK2 gene stands for Checkpoint Kinase 2 and is plays a role in cancer. This gene is a protein kinase. A protein kinase is involved in the phosphorylation of proteins. In other words, they add phosphate groups to proteins in order to regulate cellular pathways. The CHEK2 gene specifically is associated with DNA repair. When DNA is damaged, the CHEK2 gene is triggered. The protein that this gene encodes is involved in tumor suppression. Thus, when a damaged, the protein begins to phosphorylate in a way that prevents the occurrence of mitosis. Thus, the damaged DNA is not replicated. However, a mutation or polymorphism of the CHEK2 gene results in the improper prevention of DNA replication. This is because, without this gene, the damaged DNA-containing cells do not undergo apoptosis, or programmed cell death. Thus, the mutated DNA is replicated, causing an increase in susceptibility of cancer. An SNP, or single nucleotide polymorphism, occurs when a single nucleotide in a gene is changed, resulting in a change in sequence of the replicated DNA. An example of this can be seen in CHEK2. Take for instance the normal allele ATT. An polymorphism of this allele is ACT. This SNP causes a change in the complementary DNA strand. Instead of having an allele of TAA, the complementary strand would have TGA instead. This small mutation in DNA if, amplified repeatedly in the body, can result in cancer.
DESIGN
This new system for Polymerase Chain Reaction, PCR, will amplify the cancer-associated DNA in order to more easily observe the presence of cancer in a patient. The primers for this will focus on the ATT-ACT mutation, amplifying the sequence with the single nucleotide polymorphism. The cancer allele forward primer will be: [TTGAGAATGTCACGTATGTAT]. Notice that the mutation is in bold. Similarly, the cancer allele reverse primer will be [AACTCTTACAGTGCATACATA]. The mutation in the complementary strand is indicated in bold as well. Due to the fact that these primers are designed to bind to DNA strands with the cancer mutation, a product will only form if the patient has the disease. For example, the normal allele, ATT, will not bind to the reverse primer because its complement is TAA, while this primer's is AGT. Primer annealing only occurs in accordance to the complementary base pairing rules of DNA.
Our primers address the following design needs
|