BME103 s2013:T900 Group9 L3

BME 103 Spring 2013	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Coley White Role(s): Protocol Planner Name: Brady Falk Name: Student Role(s) Name: Student Role(s) LAB 3 WRITE-UP Original System: PCR Results PCR Test Results Sample Name Ave. INTDEN* Calculated μg/mL Conclusion (pos/neg) Positive Control (+) 4438005 --- N/A Negative Control(-) 2361911 --- N/A Tube Label: A1 Patient ID: 10840 rep 1 818350 --- Neg Tube Label:A2 Patient ID: 10840 rep 2 829045 --- Neg Tube Label:A3 Patient ID: 10840 rep 3 331978 --- Neg Tube Label:B1 Patient ID: 12675 rep 1 905925 --- Neg Tube Label:B2 Patient ID: 12675 rep 2 540926 --- Neg Tube Label:B3 Patient ID: 12675 rep 3 2729798 --- Pos * Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images Bayesian Statistics These following conditional statistics are based upon all of the DNA detection system results that were obtained in the PCR lab for 20 hypothetical patients who were diagnosed as either having cancer or not having cancer. Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B) Calculation 1: The probability that the sample actually has the cancer DNA sequence, given a positive diagnostic signal. A = [text description] = [frequency shown as a fraction] = [final numerical value] B = [text description] = [frequency shown as a fraction] = [final numerical value] P (B|A) = [text description] = [frequency shown as a fraction] = [final numerical value] P(A|B) = [answer] Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence. A = [text description] = [frequency shown as a fraction] = [final numerical value] B = [text description] = [frequency shown as a fraction] = [final numerical value] P (B|A) = [text description] = [frequency shown as a fraction] = [final numerical value] P(A|B) = [answer] New System: Design Strategy We concluded that a good system Must Have: [Must have #1 - why? short, ~4 or 5 sentences] [Must have #2 - why? short, ~4 or 5 sentences] We concluded that we would Want a good system to have: [Want #1 - why? short, ~4 or 5 sentences] [Want #2 - why? short, ~4 or 5 sentences] We concluded that a good system Must Not Have: [Must Not Have #1 - why? short, ~4 or 5 sentences] [Must Not Have #2 - why? short, ~4 or 5 sentences] We concluded that a good system Should Avoid: [Should Avoid #1 - why? short, ~4 or 5 sentences] [Should Avoid #2 - why? short, ~4 or 5 sentences] New System: Machine/ Device Engineering SYSTEM DESIGN KEY FEATURES We chose to include these new features Feature 1 - Heat Resistant Exterior - explanation of how this addresses any of the specifications in the "New System: Design Strategy" section Feature 2 - explanation of how this addresses any of the specifications in the "New System: Design Strategy" section Etc. [OR] We chose keep the devices the same as the original system Feature 1 - explanation of how a pre-existing feature addresses any of the specifications in the "New System: Design Strategy" section Feature 2 - explanation of how a pre-existing feature addresses any of the specifications in the "New System: Design Strategy" section Etc. INSTRUCTIONS New System: Protocols DESIGN We chose to include these new approaches/ features Feature 1 - explanation of how this addresses any of the specifications in the "New System: Design Strategy" section Feature 2 - explanation of how this addresses any of the specifications in the "New System: Design Strategy" section Etc. [OR] We chose keep the protocols the same as the original system Feature 1 - explanation of how a pre-existing feature addresses any of the specifications in the "New System: Design Strategy" section Feature 2 - explanation of how a pre-existing feature addresses any of the specifications in the "New System: Design Strategy" section Etc. MATERIALS Supplied in the Kit Amount ________ ________ ________ ________ ________ ________ ________ ________ ________ ________ ________ ________ ________ ________ Supplied by User Amount Camera 1 SYBR-Green I ________ DNA sample ________ ________ ________ ________ ________ ________ ________ ________ ________ PROTOCOLS PCR Protocol Step 1 Step 2 Etc. DNA Measurement and Analysis Protocol Step 1 Step 2 Etc. New System: Research and Development BACKGROUND CHEK2 gene stands for Checkpoint Kinase 2 and is plays a role in cancer. This gene is a protein kinase. A protein kinase is involved in the phosphorylation of proteins. In other words, they add phosphate groups to proteins in order to regulate cellular pathways. The CHEK2 gene specifically is associated with DNA repair. When DNA is damaged, the CHEK2 gene is triggered. The protein that this gene encodes is involved in tumor suppression. Thus, when a damaged, the protein begins to phosphorylate in a way that prevents the occurrence of mitosis. Thus, the damaged DNA is not replicated. However, a mutation or polymorphism of the CHEK2 gene results in the improper prevention of DNA replication. This is because, without this gene, the damaged DNA-containing cells do not undergo apoptosis, or programmed cell death. Thus, the mutated DNA is replicated, causing an increase in susceptibility of cancer. An SNP, or single nucleotide polymorphism, occurs when a single nucleotide in a gene is changed, resulting in a change in sequence of the replicated DNA. An example of this can be seen in CHEK2. Take for instance the normal allele ATT. An polymorphism of this allele is ACT. This SNP causes a change in the complementary DNA strand. Instead of having an allele of TAA, the complementary strand would have TGA instead. This small mutation in DNA if, amplified repeatedly in the body, can result in cancer. DESIGN Primers for PCR This new system for Polymerase Chain Reaction, PCR, will amplify the cancer-associated DNA in order to more easily observe the presence of cancer in a patient. The primers for this will focus on the ATT-ACT mutation, amplifying the sequence with the single nucleotide polymorphism. The cancer allele forward primer will be: [TTGAGAATGTCACGTATGTAT]. Notice that the mutation is in bold. Similarly, the cancer allele reverse primer will be [AACTCTTACAGTGCATACATA]. The mutation in the complementary strand is indicated in bold as well. Due to the fact that these primers are designed to bind to DNA strands with the cancer mutation, a product will only form if the patient has the disease. For example, the normal allele, ATT, will not bind to the reverse primer because its complement is TAA, while this primer's is AGT. Primer annealing only occurs in accordance to the complementary base pairing rules of DNA. Our primers address the following design needs These primers bind to the cancer gene, amplifying a mutated sequence. Due to this, the presence of cancer is easy to detect, increasing the efficiency of the PCR process. What is more, this results in more precise results, because annealing will only occur if cancer is present. New System: Software [THIS SECTION IS OPTIONAL. If your team has creative ideas for new software, and new software is a key component included in your new protocols, R&D, or machine design, you may describe it here. You will not receive bonus points, but a solid effort may raise your overall page layout points. If you decide not to propose new software, please delete this entire section, including the ==New System: Software== header.]