BME103 s2013:T900 Group9 L3

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
(New System: Machine/ Device Engineering)
(New System: Machine/ Device Engineering)
Line 139: Line 139:
'''STEP-BY-STEP INSTRUCTIONS''' <br>
'''STEP-BY-STEP INSTRUCTIONS''' <br>
-
1.  
+
1. Synchronize the somftware to ensure precise accuracy <br>
-
2.  
+
2. Place the DNA sample into the slots in the heating lid <br>
-
3.  
+
3. Press the start button on ''Open PCR'' software <br>
-
4.  
+
4. Let sit for the designatated time <br>
-
5.  
+
5. Take out the samples <br>
-
6.  
+
6. Analyze the results <br>
<!-- Changing the machine will require new instructions for using the machine. Write a short step-by-step list of instructions on how to set up and use the new machine. The instructions must be specific to your new design. -->
<!-- Changing the machine will require new instructions for using the machine. Write a short step-by-step list of instructions on how to set up and use the new machine. The instructions must be specific to your new design. -->

Revision as of 23:13, 15 April 2013

BME 103 Spring 2013 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Image:BME494_Asu_logo.png

Contents

OUR TEAM

Name: Coley WhiteRole(s): Protocol Planner
Name: Coley White
Role(s): Protocol Planner
Name: Brady Falk
Name: Brady Falk
Name: StudentRole(s)
Name: Student
Role(s)
Name: StudentRole(s)
Name: Student
Role(s)

LAB 3 WRITE-UP

Original System: PCR Results

PCR Test Results

Sample Name Ave. INTDEN* Calculated μg/mL Conclusion (pos/neg)
Positive Control (+) 4438005 --- N/A
Negative Control(-) 2361911 --- N/A
Tube Label: A1 Patient ID: 10840 rep 1 818350 --- Neg
Tube Label:A2 Patient ID: 10840 rep 2 829045 --- Neg
Tube Label:A3 Patient ID: 10840 rep 3 331978 --- Neg
Tube Label:B1 Patient ID: 12675 rep 1 905925 --- Neg
Tube Label:B2 Patient ID: 12675 rep 2 540926 --- Neg
Tube Label:B3 Patient ID: 12675 rep 3 2729798 --- Pos

* Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images


Bayesian Statistics
These following conditional statistics are based upon all of the DNA detection system results that were obtained in the PCR lab for 20 hypothetical patients who were diagnosed as either having cancer or not having cancer.

Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B)


Calculation 1: The probability that the sample actually has the cancer DNA sequence, given a positive diagnostic signal.

  • A = [text description] = [frequency shown as a fraction] = [final numerical value]
  • B = [text description] = [frequency shown as a fraction] = [final numerical value]
  • P (B|A) = [text description] = [frequency shown as a fraction] = [final numerical value]
  • P(A|B) = [answer]



Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence.

  • A = [text description] = [frequency shown as a fraction] = [final numerical value]
  • B = [text description] = [frequency shown as a fraction] = [final numerical value]
  • P (B|A) = [text description] = [frequency shown as a fraction] = [final numerical value]
  • P(A|B) = [answer]



New System: Design Strategy

We concluded that a good system Must Have:

  • [Must have #1 - why? short, ~4 or 5 sentences]
  • [Must have #2 - why? short, ~4 or 5 sentences]


We concluded that we would Want a good system to have:

  • [Want #1 - why? short, ~4 or 5 sentences]
  • [Want #2 - why? short, ~4 or 5 sentences]


We concluded that a good system Must Not Have:

  • [Must Not Have #1 - why? short, ~4 or 5 sentences]
  • [Must Not Have #2 - why? short, ~4 or 5 sentences]


We concluded that a good system Should Avoid:

  • [Should Avoid #1 - why? short, ~4 or 5 sentences]
  • [Should Avoid #2 - why? short, ~4 or 5 sentences]




New System: Machine/ Device Engineering

SYSTEM DESIGN


KEY FEATURES

We chose to include these new features

  • Feature 1 - Heat Resistant Exterior - The heat resistant exterior is a main concern that our group had with the original product. As soon as we realized that the machine would be heating up to temperatures that would easily start the thin plywood on fire, it was obvious that the materials needed to be changed. The new material that we will use will be a thin sheet of metal that is light and has an extremely high melting point. The metal needs to be light so that it can be portable, and the melting point needs to be high so that the temperatures in the system do not melt the machine. The meltal also needs to have low conductivity because the outside of the machine can't be hot while the operator is working with the device.
  • Feature 2 - explanation of how this addresses any of the specifications in the "New System: Design Strategy" section
  • Etc.

[OR]

We chose keep the devices the same as the original system

  • Feature 1 - explanation of how a pre-existing feature addresses any of the specifications in the "New System: Design Strategy" section
  • Feature 2 - explanation of how a pre-existing feature addresses any of the specifications in the "New System: Design Strategy" section
  • Etc.


STEP-BY-STEP INSTRUCTIONS
1. Synchronize the somftware to ensure precise accuracy
2. Place the DNA sample into the slots in the heating lid
3. Press the start button on Open PCR software
4. Let sit for the designatated time
5. Take out the samples
6. Analyze the results





New System: Protocols

DESIGN

We chose to include these new approaches/ features

  • Feature 1 - explanation of how this addresses any of the specifications in the "New System: Design Strategy" section
  • Feature 2 - explanation of how this addresses any of the specifications in the "New System: Design Strategy" section
  • Etc.

[OR]

We chose keep the protocols the same as the original system

  • Feature 1 - explanation of how a pre-existing feature addresses any of the specifications in the "New System: Design Strategy" section
  • Feature 2 - explanation of how a pre-existing feature addresses any of the specifications in the "New System: Design Strategy" section
  • Etc.


MATERIALS


Supplied in the Kit Amount
________ ________
________ ________
________ ________
________ ________
________ ________
________ ________
________ ________
Supplied by User Amount
Camera 1
SYBR-Green I ________
DNA sample ________
________ ________
________ ________
________ ________
________ ________


PROTOCOLS

  • PCR Protocol
  1. Step 1
  2. Step 2
  3. Etc.


  • DNA Measurement and Analysis Protocol
  1. Step 1
  2. Step 2
  3. Etc.



New System: Research and Development

BACKGROUND

    CHEK2 gene stands for Checkpoint Kinase 2 and is plays a role in cancer.  This gene is a protein kinase.  A protein kinase is involved in the phosphorylation of proteins.  In other words, they add phosphate groups to proteins in order to regulate cellular pathways.  The CHEK2 gene specifically is associated with DNA repair.  When DNA is damaged, the CHEK2 gene is triggered.  The protein that this gene encodes is involved in tumor suppression.  Thus, when a damaged, the protein begins to phosphorylate in a way that prevents the occurrence of mitosis.  Thus, the damaged DNA is not replicated.  However, a mutation or polymorphism of the CHEK2 gene results in the improper prevention of DNA replication.  This is because, without this gene, the damaged DNA-containing cells do not undergo apoptosis, or programmed cell death.  Thus, the mutated DNA is replicated, causing an increase in susceptibility of cancer.  
    An SNP, or single nucleotide polymorphism, occurs when a single nucleotide in a gene is changed, resulting in a change in sequence of the replicated DNA.  An example of this can be seen in CHEK2.  Take for instance the normal allele ATT.  An polymorphism of this allele is ACT.  This SNP causes a change in the complementary DNA strand.  Instead of having an allele of TAA, the complementary strand would have TGA instead.  This small mutation in DNA if, amplified repeatedly in the body, can result in cancer. 


DESIGN


Primers for PCR

    This new system for Polymerase Chain Reaction, PCR, will amplify the cancer-associated DNA in order to more easily observe the presence of cancer in a patient.  The primers for this will focus on the ATT-ACT mutation, amplifying the sequence with the single nucleotide polymorphism.  The cancer allele forward primer will be: [TTGAGAATGTCACGTATGTAT].  Notice that the mutation is in bold.  Similarly, the cancer allele reverse primer will be [AACTCTTACAGTGCATACATA].  The mutation in the complementary strand is indicated in bold as well.  
    Due to the fact that these primers are designed to bind to DNA strands with the cancer mutation, a product will only form if the patient has the disease.  For example, the normal allele, ATT, will not bind to the reverse primer because its complement is TAA, while this primer's is  AGT.  Primer annealing only occurs in accordance to the complementary base pairing rules of DNA.


Our primers address the following design needs

  • These primers bind to the cancer gene, amplifying a mutated sequence. Due to this, the presence of cancer is easy to detect, increasing the efficiency of the PCR process. What is more, this results in more precise results, because annealing will only occur if cancer is present.




New System: Software

[THIS SECTION IS OPTIONAL. If your team has creative ideas for new software, and new software is a key component included in your new protocols, R&D, or machine design, you may describe it here. You will not receive bonus points, but a solid effort may raise your overall page layout points. If you decide not to propose new software, please delete this entire section, including the ==New System: Software== header.]



Personal tools