BME103 s2013:T900 Group9 L3

BME 103 Spring 2013	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Coley White Role(s): Protocol Planner Name: Brady Falk, Commander Role: Machine Operator Name: Student Role(s) Name: Student Role(s) LAB 3 WRITE-UP Original System: PCR Results PCR Test Results Sample Name Ave. INTDEN* Calculated μg/mL Conclusion (pos/neg) Positive Control (+) 4438005 --- N/A Negative Control(-) 2361911 --- N/A Tube Label: A1 Patient ID: 10840 rep 1 818350 --- Neg Tube Label:A2 Patient ID: 10840 rep 2 829045 --- Neg Tube Label:A3 Patient ID: 10840 rep 3 331978 --- Neg Tube Label:B1 Patient ID: 12675 rep 1 905925 --- Neg Tube Label:B2 Patient ID: 12675 rep 2 540926 --- Neg Tube Label:B3 Patient ID: 12675 rep 3 2729798 --- Pos * Ave. INTDEN = Average of ImageJ integrated density values from three Fluorimeter images Bayesian Statistics These following conditional statistics are based upon all of the DNA detection system results that were obtained in the PCR lab for 20 hypothetical patients who were diagnosed as either having cancer or not having cancer. Bayes Theorem equation: P(A|B) = P(B|A) * P(A) / P(B) Calculation 1: The probability that the sample actually has the cancer DNA sequence, given a positive diagnostic signal. A = [text description] = [frequency shown as a fraction] = [final numerical value] B = [text description] = [frequency shown as a fraction] = [final numerical value] P (B|A) = [text description] = [frequency shown as a fraction] = [final numerical value] P(A|B) = [answer] Calculation 3: The probability that the patient will develop cancer, given a cancer DNA sequence. A = [text description] = [frequency shown as a fraction] = [final numerical value] B = [text description] = [frequency shown as a fraction] = [final numerical value] P (B|A) = [text description] = [frequency shown as a fraction] = [final numerical value] P(A|B) = [answer] New System: Design Strategy We concluded that a good system Must Have: [Must have #1 - why? short, ~4 or 5 sentences] [Must have #2 - why? short, ~4 or 5 sentences] We concluded that we would Want a good system to have: [Want #1 - why? short, ~4 or 5 sentences] [Want #2 - why? short, ~4 or 5 sentences] We concluded that a good system Must Not Have: [Must Not Have #1 - why? short, ~4 or 5 sentences] [Must Not Have #2 - why? short, ~4 or 5 sentences] We concluded that a good system Should Avoid: [Should Avoid #1 - why? short, ~4 or 5 sentences] [Should Avoid #2 - why? short, ~4 or 5 sentences] New System: Machine/ Device Engineering SYSTEM DESIGN The only thing chaged in our design is the type of material used. Our materials will be changed to be cheaper, and to provide for a safer machine. Photo of the Single-Drop Fluorimeter Device. (Image used from Google Images, http://openwetware.org/wiki/BME103:T130_Group_6) The Flourimeter device design will be unchanged. It worked well for these particular experiments, and the design does not need to be changed. The purpose of the Fluorimter is to detect certain substances within the DNA, using a fluorescent dye that shows positive for the type of case that is being tested. The device is suposed to be used by putting drops of dye in the tray so that a beam of light shines through. The whole device in a dark box, which shows whether or not the dye is fluorescent. A camera is placed facing the drop, and takes a picture so that the drop can be analyzed using Image J software on the computer. Photo of Open PCR Machine. The only thing that will be changed in the Open PCR design is the type of materials that will be used. It was found that the results of the lab came back accurate, giving no reason for the design of the machine to be changed. The only changes will be because of safety concerns. The Open PCR Machine has an exterior made of thin plywood, easily able to catch on fire with the high temperatures that it is dealing with. The new design will have an exterior made of metal, making sure that no fire hazards exist. The purpose of the Open PCR machine is to send DNA samples through cycles of heating up and cooling down, priming them to be analyzed by the Fluorimeter device. KEY FEATURES We chose to include these new features Feature 1 - Heat Resistant Exterior - The heat resistant exterior is a main concern that our group had with the original product. As soon as we realized that the machine would be heating up to temperatures that would easily start the thin plywood on fire, it was obvious that the materials needed to be changed. The new material that we will use will be a thin sheet of metal that is light and has an extremely high melting point. The metal needs to be light so that it can be portable, and the melting point needs to be high so that the temperatures in the system do not melt the machine. The meltal also needs to have low conductivity because the outside of the machine can't be hot while the operator is working with the device. Feature 2 - explanation of how this addresses any of the specifications in the "New System: Design Strategy" section STEP-BY-STEP INSTRUCTIONS 1. Synchronize the somftware to ensure precise accuracy 2. Place the DNA sample into the slots in the heating lid 3. Press the start button on Open PCR software 4. Let sit for the designatated time 5. Take out the samples 6. Analyze the results New System: Protocols DESIGN We chose to include these new approaches/ features Feature 1 - explanation of how this addresses any of the specifications in the "New System: Design Strategy" section Feature 2 - explanation of how this addresses any of the specifications in the "New System: Design Strategy" section Etc. MATERIALS Supplied in the Kit Reaction Mix (MgCl2, dNTP's,Taq DNA polymerase) Software Supplied by User Camera SYBR-Green I DNA sample Primer mix (forward & reverse primer) PROTOCOLS PCR Protocol Before preparing the samples, the software to run the Polymerase Chain Reaction (PCR) machine needs to be downloaded from the website. First, use a micropipette to transfer 50 μL of the given PCR reaction mix into the corresponding tube. Then, transfer 50 μL of the DNA/ primer mix to the corresponding tube. If more than one sample is being tested then the tubes must be carefully labeled. After the samples are mixed, the tubes need to be placed into the Polymerase Chain Reaction (PCR) Machine. Open up the software and program the cycle to run for the appropriate time, outlined below. Thermal Cycler Program Heated Lid: 110°C Initial Step: temp: 95°C time: 180 sec Number of Cycles: 35 Denaturing: temp: 95°C time: 30 sec Annealing: temp: 57°C time: 30 sec Extending: temp: 72°C time: 30 sec Final Hold: temp: 4°C DNA Measurement and Analysis Protocol To begin the DNA measurement and analysis, you have to calibrate the machine with the negative sample. First you step up the single drop fluorimeter and set up your phone with the correct settings. Then using a micropipette, place 80 µL of the SYBR I green onto the hydrophobic tray. Following the SYBR I green place 80 µL of the DNA mix sample. Then turn on the light and prepare to take a picture of the droplet under the box, cutting out as much light as possible. The next steps involve the use of Image J that can be downloaded from the internet for free. Upload the picture taken and New System: Research and Development BACKGROUND CHEK2 gene stands for Checkpoint Kinase 2 and is plays a role in cancer. This gene is a protein kinase. A protein kinase is involved in the phosphorylation of proteins. In other words, they add phosphate groups to proteins in order to regulate cellular pathways. The CHEK2 gene specifically is associated with DNA repair. When DNA is damaged, the CHEK2 gene is triggered. The protein that this gene encodes is involved in tumor suppression. Thus, when a damaged, the protein begins to phosphorylate in a way that prevents the occurrence of mitosis. Thus, the damaged DNA is not replicated. However, a mutation or polymorphism of the CHEK2 gene results in the improper prevention of DNA replication. This is because, without this gene, the damaged DNA-containing cells do not undergo apoptosis, or programmed cell death. Thus, the mutated DNA is replicated, causing an increase in susceptibility of cancer. An SNP, or single nucleotide polymorphism, occurs when a single nucleotide in a gene is changed, resulting in a change in sequence of the replicated DNA. An example of this can be seen in CHEK2. Take for instance the normal allele ATT. An polymorphism of this allele is ACT. This SNP causes a change in the complementary DNA strand. Instead of having an allele of TAA, the complementary strand would have TGA instead. This small mutation in DNA if, amplified repeatedly in the body, can result in cancer. DESIGN Primers for PCR This new system for Polymerase Chain Reaction, PCR, will amplify the cancer-associated DNA in order to more easily observe the presence of cancer in a patient. The primers for this will focus on the ATT-ACT mutation, amplifying the sequence with the single nucleotide polymorphism. The cancer allele forward primer will be: [TTGAGAATGTCACGTATGTAT]. Notice that the mutation is in bold. Similarly, the cancer allele reverse primer will be [AACTCTTACAGTGCATACATA]. The mutation in the complementary strand is indicated in bold as well. Due to the fact that these primers are designed to bind to DNA strands with the cancer mutation, a product will only form if the patient has the disease. For example, the normal allele, ATT, will not bind to the reverse primer because its complement is TAA, while this primer's is AGT. Primer annealing only occurs in accordance to the complementary base pairing rules of DNA. Our primers address the following design needs These primers bind to the cancer gene, amplifying a mutated sequence. Due to this, the presence of cancer is easy to detect, increasing the efficiency of the PCR process. What is more, this results in more precise results, because annealing will only occur if cancer is present.