BME494 Project Group2

Home        People        Course Projects        Course Materials        Syllabus        Photos        Wiki Editing Help       

ABSTRACT File:BME494 placeholder Write a description of the image here Within the foot of the mussel there are five mussel proteins that vary by amount. This varying amount is caused by the differing amounts of DOPA present within the proteins. These proteins are what cause the adhesive properties present within a mussel. What we aimed to do is create a controllable configuration of cells so that adhesion to a surface can be easily toggled. BACKGROUND A mussel exhibiting adhesion to a surface Bioadhesives are natural polymeric materials that many organisms, such as mussels, use for their adhesive properties. Bioadhesives have been seen as an excellent alternative to human-made substances as they are very and durable in conjunction with being eco-friendly. In addition, they exhibit properties that allow them to be used in underwater and medical applications which is the main interest of this project. PROOF OF CONCEPT DESIGN New Natural Part Mussel Adhesive Protein Mgfp-1 is our Natural Part We are using it to test its ability to increase the adhesive properties of a substance to use as a glue in aqueous environments like in dentistry. We found this part when searching for adhesive proteins from mussels and first found a trademark Cell-Tak who sold Mgfp-1 but from protein extraction methods. We then found that Idaho National Laboratory (INL) has a patent (number 6987170) and has sequenced the protein such that PCR reactions can mass produce it. Part of the sequence was copied from INL and then located in Genbank. Creation of Primers Forward Primer matches beginning of Mefp-1 protein sequence: ATGGAGGGAAATCAAATTA Bio-brick prefix for primer that starts with ATG is: GAATTCGCGGCCGCTTCTAG Gives full forward bio-brick primer: GAATTCGCGGCCGCTTCTAGATGGAGGGAAATCAAATTA The end of the Mefp-1 protein sequence:TATCCATCACAATATTAA Reverse primer:TTAATATTGTGATGGATA Bio-brick suffix: TACTAGTAGCGGCCGCTGCAGCTGCA Full reverse bio-brick primer: AAGGCTGCAGCGGCCGCTACTAGTTTAATATTGTGATGGATA Note: potential problem with lack of CG clamp and low CG ratio Key Pre-existing Part We are also using Mefp-5 which has already been bio-bricked and used by UC Berkeley: 2009 and TU Delft: 2011. It has been shown to function as a sticky adhesive and worked toward a couple products. Using it in the product functions as a sort of control to verify testing procedures and we plan on evaluating the combined effect of Mefp-1 and Mefp-5. Assembly Scheme File:BME494 placeholder TESTING Measurement We are measuring the adhesiveness of the glue by the amount of fluorescence observed. This gives us an easily visible measure of the binding dissociation rate of the glue. Expected Observations We expect to see a quasi-linear relationship between adhesive power and glowing intensity. This is because the GFP is being produced in the same plasmid cycle as the adhesive protein. The adhesive power could be monitored to support these conclusion through high cost equipment such as SPR. Tuning Our System HUMAN PRACTICES OUR TEAM Caroline Hom Major: Biomedical Engineering Why I’m taking the course: I want to gain a better understanding of synthetic biology that I can apply to my research An interesting fact about myself: I’ve lived in Arizona since I was 3, but my favorite thing to do is surf. Caroline Hom's Wiki Joshua Carroll Major: Biomedical Engineering Why I’m taking the course: I want to learn applicable skills toward the tissue engineering discipline. An interesting fact about myself: I made this cake to celebrate Arizona's 100th birthday-February 14th 2012 Your Name Major: Biomedical Engineering Why I’m taking the course: An interesting fact about myself: You may add a link to your personal OWW page.