<!--Make some "mock data" to demonstrate sound experimental design (controls, significance, etc.)-->
<!--Make some "mock data" to demonstrate sound experimental design (controls, significance, etc.)-->
[[Image:BME494_PG2EO.jpg|600px]]
<br>
<br>
We expect to see a quasi-linear relationship between adhesive power and glowing intensity. This is because the GFP is being produced in the same plasmid cycle as the adhesive protein. The adhesive power could be monitored to support these conclusion through high cost equipment such as the AFM cantilever.
We expect to see a quasi-linear relationship between adhesive power and glowing intensity. This is because the GFP is being produced in the same plasmid cycle as the adhesive protein. The adhesive power could be monitored to support these conclusion through high cost equipment such as the AFM cantilever.
Within the foot of the mussel there are five mussel proteins that vary by amount. This varying amount is caused by the differing amounts of DOPA present within the proteins. These proteins are what cause the adhesive properties present within a mussel. What we aimed to do is create a controllable configuration of cells so that adhesion to a surface can be easily toggled.
BACKGROUND
Bioadhesives are natural polymeric materials that many organisms, such as mussels, use for their adhesive properties. Bioadhesives have been seen as an excellent alternative to human-made substances as they are very and durable in conjunction with being eco-friendly. In addition, they exhibit properties that allow them to be used in underwater and medical applications which is the main interest of this project.
PROOF OF CONCEPT DESIGN
New Natural Part
Mussel Adhesive Protein Mgfp-1 is our Natural Part
We are using it to test its ability to increase the adhesive properties of a substance to use as a glue in aqueous environments like in dentistry.
We found this part when searching for adhesive proteins from mussels and first found a trademark Cell-Tak who sold Mgfp-1 but from protein extraction methods. We then found that Idaho National Laboratory (INL) has a patent (number 6987170) and has sequenced the protein such that PCR reactions can mass produce it. Part of the sequence was copied from INL and then located in Genbank.
Creation of Primers
Forward Primer matches beginning of Mefp-1 protein sequence: ATGGAGGGAAATCAAATTA
Bio-brick prefix for primer that starts with ATG is: GAATTCGCGGCCGCTTCTAG
Gives full forward bio-brick primer: GAATTCGCGGCCGCTTCTAGATGGAGGGAAATCAAATTA
The end of the Mefp-1 protein sequence:TATCCATCACAATATTAA
Reverse primer:TTAATATTGTGATGGATA
Bio-brick suffix: TACTAGTAGCGGCCGCTGCAGCTGCA
Full reverse bio-brick primer: AAGGCTGCAGCGGCCGCTACTAGTTTAATATTGTGATGGATA
Note: potential problem with lack of CG clamp and low CG ratio
Key Pre-existing Part
We are also using Mefp-5 which has already been bio-bricked and used by UC Berkeley: 2009 and TU Delft: 2011.
It has been shown to function as a sticky adhesive and worked toward a couple products.
Using it in the product functions as a sort of control to verify testing procedures and we plan on evaluating the combined effect of Mefp-1 and Mefp-5.
Measurement
We are measuring the adhesiveness of the glue by the amount of fluorescence observed. This gives us an easily visible measure of how strongly the glue is adhered. The fluorescence intensity will be verified against adhesive testing using an AFM cantilever. Furthermore, we have built in both green and red fluorescence with the green correlating to Mgfp-1 and red to Mgfp-5. This will allow us quantify the relative amounts of each protein and the effect on the adhesive power.
Expected Observations
We expect to see a quasi-linear relationship between adhesive power and glowing intensity. This is because the GFP is being produced in the same plasmid cycle as the adhesive protein. The adhesive power could be monitored to support these conclusion through high cost equipment such as the AFM cantilever.
Tuning Our System
HUMAN PRACTICES
OUR TEAM
Major: Biomedical Engineering
Why I’m taking the course: I want to gain a better understanding of synthetic biology that I can apply to my research
An interesting fact about myself: I’ve lived in Arizona since I was 3, but my favorite thing to do is surf.