BME494 Project Group5

Home        People        Course Projects        Course Materials        Syllabus        Photos        Wiki Editing Help       

ABSTRACT File:BME494 placeholder Write a description of the image here In this study we looked at the possibility of making an E. coli strain that has a plasmid which will allow for the production of gonadotropin-releasing hormone (GnRH) to help increase the level of testosterone. Low levels of testosterone stimulate the production of GnRH which indirectly stimulates the production of more testosterone via lutenizing hormone and follicle stimulating hormone. To show proof-of-concept, two plasmids were constructed working as a repressilator to have isolated production of both GnRH and the reporter molecule green fluorescent protein (GFP). Theoritically, having one plasmid create GnRH and the repressor for the GFP plasmid and the other plasmid create GFP and repressor for the GnRH plasmid will allow for isolated production of both to show expression characteristics of GnRH being produced. Further testing must be done to address correct protein folding and activity. Using this proof-of-concept, it is hoped to develop a human-viable chassis to help those affected with hypotestosteronism. However, human practices involving genetically modified organisms to be “implanted” or given to humans still remains subject to debate in the scientific community. BACKGROUND File:BME494 placeholder Write a description of the image here This plasmid theoretically corrects for secondary male hypogonadism by regulating in vivo GnRH production. This would virtually eliminate the need for testosterone supplements by manipulating the body’s natural E. coli to trigger the testosterone releasing pathway. This works by supplements the GnRH not adequately produced in the hypothalamus, which triggers the secretion of FSH and LH, which trigger testosterone production in the testes. PROOF OF CONCEPT DESIGN The natural part for our project is Gonadotropin Releasing Hormone (GnRH) and has the gene # 2796 in NCBI GeneBank database. Although this gene is 5,783 bp in length, the actual protein created from the gene is only 279 bp in length. We plan on having the cDNA of this gene synthesized for us to also include the BioBrick prefix and suffix and then use it for other cloning purposes to create our proof-of-concept test system. With the prefix and suffix the gene is a total of 320 bp in length. File:BME494 placeholder Primers: Without the prefix and suffix; only GnRH: Forward: ATGAAGCCAATTCAAAAACTCCTA Reverse: TTAAATCTTCTTCTGCCCAGTTTA With the prefix and suffix: Forward GAATTCGCGGCCGCTTCTAGATGAAG Reverse GTTTATACTAGTAGCGGCCGCTGCAG New Natural Part: Why are you using this part? How did you find this part? What database/ resources did you use? What primers will you use to isolate it and turn it into a BioBrick? Key Pre-existing Part: If you didn't need to use a new natural part, describe one important pre-existing BioBrick from the parts registry.org that you will use. Why are you using it? Describe how well-documented the part is. Do you trust it? Assembly Scheme File:BME494 placeholder TESTING Measurement Expected Observations File:BME494 placeholde.jpg Tuning Our System File:BME494 placeholdr.jpg HUMAN PRACTICES OUR TEAM Your Name Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page. Your Name Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page. Your Name Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page. Your Name Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page.