BME494 Project Group5

From OpenWetWare

Revision as of 13:41, 15 March 2012 by William L. Meeks (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search
Image:BME494_Group5_Title.jpg
Image:BME494_Asu_logo.png

Home        People        Course Projects        Course Materials        Syllabus        Photos        Wiki Editing Help       

Contents

ABSTRACT

Image:BME494 placeholder
Write a description of the image here

In this study we looked at the possibility of making an E. coli strain that has a plasmid which will allow for the production of gonadotropin-releasing hormone (GnRH) to help increase the level of testosterone. Low levels of testosterone stimulate the production of GnRH which indirectly stimulates the production of more testosterone via lutenizing hormone and follicle stimulating hormone. To show proof-of-concept, two plasmids were constructed working as a repressilator to have isolated production of both GnRH and the reporter molecule green fluorescent protein (GFP). Theoritically, having one plasmid create GnRH and the repressor for the GFP plasmid and the other plasmid create GFP and repressor for the GnRH plasmid will allow for isolated production of both to show expression characteristics of GnRH being produced. Further testing must be done to address correct protein folding and activity. Using this proof-of-concept, it is hoped to develop a human-viable chassis to help those affected with hypotestosteronism. However, human practices involving genetically modified organisms to be “implanted” or given to humans still remains subject to debate in the scientific community.






BACKGROUND

Image:BME494 placeholder
Write a description of the image here


This plasmid theoretically corrects for secondary male hypogonadism by regulating in vivo GnRH production. This would virtually eliminate the need for testosterone supplements by manipulating the body’s natural E. coli to trigger the testosterone releasing pathway. This works by supplements the GnRH not adequately produced in the hypothalamus, which triggers the secretion of FSH and LH, which trigger testosterone production in the testes.

PROOF OF CONCEPT DESIGN

The natural part for our project is Gonadotropin Releasing Hormone (GnRH) and has the gene #2796 in NCBI GeneBank database[1]. Although this gene is 5,783 bp in length, the actual protein created from the gene is only 279 bp in length. We plan on having the cDNA of this gene synthesized for us to also include the BioBrick prefix and suffix and then use it for other cloning purposes to create our proof-of-concept test system. Also, we plan on having the GnRH exported from the E. coli cell with the use of a 60 bp signal from HlyA to use the T1SS[2]. While this is a proof of concept test, eventually there will be the need to export the protein if this project moves into human systems. This 60 bp will be added to the C-terminus of GnRH to where then the prefix and suffice with flank the entirety. With the prefix and suffix the gene is a total of 320 bp in length. With the signal sequence the gene is 380 bp in length.


The overall goal of our project is to use a two plasmid system that would regulate each other by producing the other's repressor. Plasmid #1 would act as the main plasmid to express GnRH and plasmid #2 would act as a main reporter expressing GFP. Plasmid #1 uses the Lac promoter and is repressed by lacI created on plasmid #2. Plasmid #2 uses the Ara promoter (pBAD) and is repressed by araC created by plasmid #1. Arabinose will repress araC and IPTG will repress lacI.

Primers:

Without the prefix and suffix; only GnRH: Forward: ATGAAGCCAATTCAAAAACTCCTA Reverse: TTAAATCTTCTTCTGCCCAGTTTA

With the prefix and suffix: Forward GAATTCGCGGCCGCTTCTAGATGAAG Reverse GTTTATACTAGTAGCGGCCGCTGCAG



Assembly Scheme


Image:BME494 placeholder







TESTING


Measurement



Expected Observations



Tuning Our System
Image:BME494 placeholdr.jpg








HUMAN PRACTICES

OUR TEAM

Your Name
Your Name
Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page.


Your Name
Your Name
Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page.


Your Name
Your Name
Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page.


Your Name
Your Name
Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page.




Personal tools