BME494 Project Group6

Home        People        Course Projects        Course Materials        Syllabus        Photos        Wiki Editing Help       

ABSTRACT Vitamin B-12 (Cobalamin) Our goal was to create a strain of E. Coli which could produce vitamin B-12 (cobalamin) to help people who have vitamin B-12 deficiency. Vitamin B-12 deficiency is especially common in vegetarians and vegans, because it is found almost exclusively in meats and dairy products. In order to achieve B-12 production in E. Coli, we extracted the DNA sequence coding for the cobW gene in Cupriavidus metallidurans using PCR, and inserted the gene into an Ampicillin resistant plasmid, linking its production to GFP for proof of concept. Although humans are fairly good at removing excess vitamin B-12 due to its solubility in water, having unrestrained B-12 production in the body still is an unnecessary risk. In order to control the production of B-12, we included a protein (linked to RFP)which can degrade vitamin B-12. By choosing ribosome binding sites with varying efficiencies, we can tune the amount of B-12 producing protein and B-12 degrading protein present in the system, which will ultimately allow us to maintain a healthy level of B-12 in the patient. If successful, we will hopefully create a safe way to help those who suffer from vitamin B-12 deficiency to enjoy a better quality of life. BACKGROUND E. Coli bacteria When picking an objective for our project, we aimed to produce a substance necessary to the survival of humans which the human body cannot produce independently. Vitamin B-12 in particular is not produced by the body, and many people, especially vegetarians and vegans, have low levels of B-12 due to the fact that it is found almost exclusively in meat and dairy products. Low levels of B-12 can lead to the expression of serious psychological symptoms including mania, psychosis, fatigue, memory impairment, irritability, depression, and personality changes. In most cases, the effects of vitamin B-12 deficiency on the nervous system are reversible. However, in certain studies, it has been linked to the onset of Alzheimer's disease. Because of the severity of symptoms associated with B-12 deficiency and relative simplicity of the cause, taking this project on seemed like a realistic and beneficial application of our time and resources. The novel aspect of this project comes from our natural part: the cobW gene we extracted from Cupriavidus metallidurans. Once our E. Coli is in a human, the human body will now have the capability to produce a substance which it previously was dependent upon external sources for, which is novel in itself. PROOF OF CONCEPT DESIGN New Natural Part: Why are you using this part? How did you find this part? What database/ resources did you use? What primers will you use to isolate it and turn it into a BioBrick? We picked this gene for several reasons, the most important of which is the fact that it can produce vitamin B12. In addition, the gene itself has relatively few base pairs, and there was no need for site directed mutagenesis because there were no BioBrick restriction sites within the base pair sequence. We found the cobW gene ([[1]]) via the NCBI database when searching for vitamin B12 synthesis. Our primers are as follows: Forward primer: gaattcgcggccgcttctagatggccgttcgtctgcccgt Reverse primer: tactagtagcggccgctgcagtcagtgtgcatgtccgcaat Assembly Scheme File:BME494 placeholder TESTING Measurement Expected Observations Tuning Our System In order to tune our system, we would need to test different ribosome binding site combinations in order to maintain the ideal level of B12. Depending on the ribosome binding site selected, we can choose the frequencies at which our B12 production and degradation genes are expressed. By observing the luminescence from the GFP and RFP, we can determine the amount of these proteins in the system, and from this data, we can estimate the B12 concentration in the system and tune the system by adjust which ribosome binding sites we use for each gene. HUMAN PRACTICES OUR TEAM Your Name Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page. Your Name Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page. Your Name Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page. Your Name Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page.