BME494 Project Group6: Difference between revisions
(17 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
<!-- This "div" contains the large header image. You can create your own and place it here. See BME494_Wiki_Help for help with uploading images to OpenWetWare and using them on your page.--> | <!-- This "div" contains the large header image. You can create your own and place it here. See BME494_Wiki_Help for help with uploading images to OpenWetWare and using them on your page.--> | ||
<div class=noprint style="width: 900px; height: 369px; color: #565051; background-color: #dcdcdc">[[Image: | <div class=noprint style="width: 900px; height: 369px; color: #565051; background-color: #dcdcdc">[[Image:Group6_header.jpg]]</div> | ||
<!-- The next two divs contain the ASU banner and the navigation menu. Do not change them. --> | <!-- The next two divs contain the ASU banner and the navigation menu. Do not change them. --> | ||
Line 36: | Line 36: | ||
==BACKGROUND== | ==BACKGROUND== | ||
[[Image: | [[Image:Group6_ecoli.jpg|thumb|frame|right|E. Coli bacteria]] | ||
When picking an objective for our project, we aimed to produce a substance necessary to the survival of humans which the human body cannot produce independently. Vitamin B-12 in particular is not produced by the body, and many people, especially vegetarians and vegans, have low levels of B-12 due to the fact that it is found almost exclusively in meat and dairy products. Low levels of B-12 can lead to the expression of serious psychological symptoms including mania, psychosis, fatigue, memory impairment, irritability, depression, and personality changes. In most cases, the effects of vitamin B-12 deficiency on the nervous system are reversible. However, in certain studies, it has been linked to the onset of Alzheimer's disease. Because of the severity of symptoms associated with B-12 deficiency and relative simplicity of the cause, taking this project on seemed like a realistic and beneficial application of our time and resources. The novel aspect of this project comes from our natural part: the cobW gene we extracted from Cupriavidus metallidurans | When picking an objective for our project, we aimed to produce a substance necessary to the survival of humans which the human body cannot produce independently. Vitamin B-12 in particular is not produced by the body, and many people, especially vegetarians and vegans, have low levels of B-12 due to the fact that it is found almost exclusively in meat and dairy products. Low levels of B-12 can lead to the expression of serious psychological symptoms including mania, psychosis, fatigue, memory impairment, irritability, depression, and personality changes. In most cases, the effects of vitamin B-12 deficiency on the nervous system are reversible. However, in certain studies, it has been linked to the onset of Alzheimer's disease. Because of the severity of symptoms associated with B-12 deficiency and relative simplicity of the cause, taking this project on seemed like a realistic and beneficial application of our time and resources. The novel aspect of this project comes from our natural part: the cobW gene we extracted from Cupriavidus metallidurans. Once our E. Coli is in a human, the human body will now have the capability to produce a substance which it previously was dependent upon external sources for, which is novel in itself. | ||
<!--Why this project? What is the significance? What is novel? 300 words or less.--> | <!--Why this project? What is the significance? What is novel? 300 words or less.--> | ||
Line 48: | Line 48: | ||
<!--Delete the line items that do not apply to your project --> | <!--Delete the line items that do not apply to your project --> | ||
We picked this gene for several reasons, the most important of which is the fact that it can produce vitamin B12. In addition, the gene itself has relatively few base pairs, and there was no need for site directed mutagenesis because there were no BioBrick restriction sites within the base pair sequence. We found the cobW gene ([[http://www.ncbi.nlm.nih.gov/gene/4036909]]) via the NCBI database when searching for vitamin B12 synthesis. Our primers are as follows: | |||
Forward primer: '''gaattcgcggccgcttctag'''atggccgttcgtctgcccgt | |||
Reverse primer: tactagtagcggccgctgcag'''tcagtgtgcatgtccgcaat''' | |||
Note: The bold sections of the primers are the standard BioBrick primers, while the other sections are specific to our natural part. | |||
<br> | <br> | ||
Line 57: | Line 62: | ||
<!--Draw out plasmids, restriction digests, antibiotics used, etc. --> | <!--Draw out plasmids, restriction digests, antibiotics used, etc. --> | ||
[[Image: | [[Image:Group6_plasmidassembly.jpg|right|400px]] | ||
Because our plasmid has ampicillin resistance and standard BioBrick restriction sites, it is fairly easy to construct our genes in the way we specify in the schematic to the right. The addition of each consecutive gene is rather formulaic. Say, for example, that we have a kanamycin resistant plasmid with a BioBricked form of RFP. Because this part is already a biobrick, it will have the E, X, S, and P restriction sites present in the nucleotide sequence. We can cut the DNA at the X and P sites to prepare the gene to be added to a new plasmid. In our specific case, our next gene is a ribosome binding site. We can prepare the plasmid containing the RBS by cutting at the E and S sites, which will then allow it to receive the RFP. Then, the environment can be treated with ampicillin, which will remove all of the plasmids from which the RFP was taken, preserving the new plasmids which have ampicillin resistance. We can repeat this same process for the addition of each gene. | |||
<br><br><br><br><br> | <br><br><br><br><br> | ||
Line 75: | Line 80: | ||
<br> | <br> | ||
<!--Make some "mock data" to demonstrate sound experimental design (controls, significance, etc.)--> | <!--Make some "mock data" to demonstrate sound experimental design (controls, significance, etc.)--> | ||
[[Image: | [[Image:group6_B12_production.jpg|600px]] | ||
[[Image:group6_Rfp_expression.jpg|600px]] | |||
[[Image:group6_Gfp_expression.jpg|600px]] | |||
Line 83: | Line 89: | ||
<br> | <br> | ||
<!--Explain how you have built in "tenability". Explain expected changes in data. Draw how the graphs would change --> | <!--Explain how you have built in "tenability". Explain expected changes in data. Draw how the graphs would change --> | ||
In order to tune our system, we would need to test different ribosome binding site combinations in order to maintain the ideal level of B12. Depending on the ribosome binding site selected, we can choose the frequencies at which our B12 production and degradation genes are expressed. By observing the luminescence from the GFP and RFP, we can determine the amount of these proteins in the system, and from this data, we can estimate the B12 concentration in the system and tune the system by adjust which ribosome binding sites we use for each gene. | |||
Line 100: | Line 104: | ||
<div style="color: #808080; background-color: #ffffff; width: 600px; padding: 5px"> | <div style="color: #808080; background-color: #ffffff; width: 600px; padding: 5px"> | ||
[[Image:BME494_profile.jpg|thumb|noframe|150px|left|''' | [[Image:BME494_profile.jpg|thumb|noframe|150px|left|'''Jeremy Blazer''']]Sophomore in Biomedical Engineering. Taking BME 494 so that he can learn how to engineer E. Coli to do his bidding. Something interesting about him is that he has a twin sister who also goes to ASU! | ||
</div> | </div> | ||
<br> | <br> |
Latest revision as of 11:26, 15 March 2012
Home People Course Projects Course Materials Syllabus Photos Wiki Editing Help
ABSTRACTOur goal was to create a strain of E. Coli which could produce vitamin B-12 (cobalamin) to help people who have vitamin B-12 deficiency. Vitamin B-12 deficiency is especially common in vegetarians and vegans, because it is found almost exclusively in meats and dairy products. In order to achieve B-12 production in E. Coli, we extracted the DNA sequence coding for the cobW gene in Cupriavidus metallidurans using PCR, and inserted the gene into an Ampicillin resistant plasmid, linking its production to GFP for proof of concept. Although humans are fairly good at removing excess vitamin B-12 due to its solubility in water, having unrestrained B-12 production in the body still is an unnecessary risk. In order to control the production of B-12, we included a protein (linked to RFP)which can degrade vitamin B-12. By choosing ribosome binding sites with varying efficiencies, we can tune the amount of B-12 producing protein and B-12 degrading protein present in the system, which will ultimately allow us to maintain a healthy level of B-12 in the patient. If successful, we will hopefully create a safe way to help those who suffer from vitamin B-12 deficiency to enjoy a better quality of life.
BACKGROUNDWhen picking an objective for our project, we aimed to produce a substance necessary to the survival of humans which the human body cannot produce independently. Vitamin B-12 in particular is not produced by the body, and many people, especially vegetarians and vegans, have low levels of B-12 due to the fact that it is found almost exclusively in meat and dairy products. Low levels of B-12 can lead to the expression of serious psychological symptoms including mania, psychosis, fatigue, memory impairment, irritability, depression, and personality changes. In most cases, the effects of vitamin B-12 deficiency on the nervous system are reversible. However, in certain studies, it has been linked to the onset of Alzheimer's disease. Because of the severity of symptoms associated with B-12 deficiency and relative simplicity of the cause, taking this project on seemed like a realistic and beneficial application of our time and resources. The novel aspect of this project comes from our natural part: the cobW gene we extracted from Cupriavidus metallidurans. Once our E. Coli is in a human, the human body will now have the capability to produce a substance which it previously was dependent upon external sources for, which is novel in itself.
PROOF OF CONCEPT DESIGNWe picked this gene for several reasons, the most important of which is the fact that it can produce vitamin B12. In addition, the gene itself has relatively few base pairs, and there was no need for site directed mutagenesis because there were no BioBrick restriction sites within the base pair sequence. We found the cobW gene ([[1]]) via the NCBI database when searching for vitamin B12 synthesis. Our primers are as follows: Forward primer: gaattcgcggccgcttctagatggccgttcgtctgcccgt Reverse primer: tactagtagcggccgctgcagtcagtgtgcatgtccgcaat Note: The bold sections of the primers are the standard BioBrick primers, while the other sections are specific to our natural part.
Because our plasmid has ampicillin resistance and standard BioBrick restriction sites, it is fairly easy to construct our genes in the way we specify in the schematic to the right. The addition of each consecutive gene is rather formulaic. Say, for example, that we have a kanamycin resistant plasmid with a BioBricked form of RFP. Because this part is already a biobrick, it will have the E, X, S, and P restriction sites present in the nucleotide sequence. We can cut the DNA at the X and P sites to prepare the gene to be added to a new plasmid. In our specific case, our next gene is a ribosome binding site. We can prepare the plasmid containing the RBS by cutting at the E and S sites, which will then allow it to receive the RFP. Then, the environment can be treated with ampicillin, which will remove all of the plasmids from which the RFP was taken, preserving the new plasmids which have ampicillin resistance. We can repeat this same process for the addition of each gene.
TESTING
HUMAN PRACTICESOUR TEAM
Sophomore in Biomedical Engineering. Taking BME 494 so that he can learn how to engineer E. Coli to do his bidding. Something interesting about him is that he has a twin sister who also goes to ASU!
Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page.
Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page.
Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page.
|