BME494 Project Group6
Home People Course Projects Course Materials Syllabus Photos Wiki Editing Help
ABSTRACTOur goal was to create a strain of E. Coli which could produce vitamin B-12 (cobalamin) to help people who have vitamin B-12 deficiency. Vitamin B-12 deficiency is especially common in vegetarians and vegans, because it is found almost exclusively in meats and dairy products. In order to achieve B-12 production in E. Coli, we extracted the DNA sequence coding for the cobW gene in Cupriavidus metallidurans using PCR, and inserted the gene into an Ampicillin resistant plasmid, linking its production to GFP for proof of concept. Although humans are fairly good at removing excess vitamin B-12 due to its solubility in water, having unrestrained B-12 production in the body still is an unnecessary risk. In order to control the production of B-12, we included a protein (linked to RFP)which can degrade vitamin B-12. By choosing ribosome binding sites with varying efficiencies, we can tune the amount of B-12 producing protein and B-12 degrading protein present in the system, which will ultimately allow us to maintain a healthy level of B-12 in the patient. If successful, we will hopefully create a safe way to help those who suffer from vitamin B-12 deficiency to enjoy a better quality of life.
BACKGROUNDWhen picking an objective for our project, we aimed to produce a substance necessary to the survival of humans which the human body cannot produce independently. Vitamin B-12 in particular is not produced by the body, and many people, especially vegetarians and vegans, have low levels of B-12 due to the fact that it is found almost exclusively in meat and dairy products. Low levels of B-12 can lead to the expression of serious psychological symptoms including mania, psychosis, fatigue, memory impairment, irritability, depression, and personality changes. In most cases, the effects of vitamin B-12 deficiency on the nervous system are reversible. However, in certain studies, it has been linked to the onset of Alzheimer's disease. Because of the severity of symptoms associated with B-12 deficiency and relative simplicity of the cause, taking this project on seemed like a realistic and beneficial application of our time and resources. The novel aspect of this project comes from our natural part: the cobW gene we extracted from Cupriavidus metallidurans. Once our E. Coli is in a human, the human body will now have the capability to produce a substance which it previously was dependent upon external sources for, which is novel in itself.
PROOF OF CONCEPT DESIGN
We picked this gene for several reasons, the most important of which is the fact that it can produce vitamin B12. In addition, the gene itself has relatively few base pairs, and there was no need for site directed mutagenesis because there were no BioBrick restriction sites within the base pair sequence. We found the cobW gene ([[1]]) via the NCBI database when searching for vitamin B12 synthesis. Our primers are as follows: Forward primer: gaattcgcggccgcttctagatggccgttcgtctgcccgt Reverse primer: tactagtagcggccgctgcagtcagtgtgcatgtccgcaat
TESTING
HUMAN PRACTICESOUR TEAM
Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page.
Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page.
Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page.
Your area of study/ academic program/ major, why you are taking BME494, and something interesting about yourself. You may add a link to your personal OWW page.
|