BME494s2013 Project Template: Difference between revisions
No edit summary |
|||
Line 37: | Line 37: | ||
<br><br><br><br><br><br><br><br> | <br><br><br><br><br><br><br><br> | ||
<!-- These are lines breaks for spacing purposes. You can add or delete these as needed --> | |||
==Background== | ==Background== | ||
[[Image: | [[Image:CirEmblemHandwriteLogo2.png|thumb|140px||left|Text describing the image]] | ||
<!-- Background information on the natural Lac operon. This should be based on Group Presentation 2 --> | |||
<br> | |||
<br><br><br><br><br><br><br><br> | |||
<!-- These are lines breaks for spacing purposes. You can add or delete these as needed --> | |||
==Proof of Concept Design== | ==Proof of Concept Design== |
Revision as of 14:37, 22 April 2013
Home People Course Projects Course Materials Schedule Photos Wiki Editing Help
Overview & Purpose
Background
Proof of Concept Design
Forward Primer :5'->GAATTCGCGGCCGCTTCTAG ATGTCGCTTACATACAAACC->3’
Testing
For our testing, we will examine the relationship between the level of concentration of the chemical compound toulene and the level of fluorescence. The fluorescence from DH5α cells harboring the constructed biobrick with the xylr protein will be measured at various concentrations of toluene.
For tuning our system, we hope to make it more effective by increasing the efficiency of the ribosome binding site. The RBS controls the accuracy and efficiency with which the translation of mRNA begins. Therefore, we hope to use this important variable to tune our system.
Human PracticesThe human practices of our project is important because it seeks to identify where these carcinogens are located in farmland areas. If these chemicals are getting into the groundwater, it poses an extreme risk to people in those areas. Problems of concern also involve the farmland animals, who eat the plants from the soil and drink the water. This is a serious issue because these chemicals get into the food that is produced. Our Team
Works Cited[1] "EARTHWORKS." EARTHWORKS. Web. 11 Mar. 2012. <http://www.earthworksaction.org/issues/detail/hydraulic_fracturing_101>. [2] "Team:Michigan/Project." IGEM 2009/Team Michigan:Project. Web. 12 Mar. 2012. <http://2009.igem.org/Team:Michigan/Project>. [3] "Water Contamination From Fracking (Hydraulic Fracturing)." Water Contamination From Shale. Web. 7 Mar. 2012. <http://www.water-contamination-from-shale.com/>. [4] "American Society for MicrobiologyApplied and Environmental Microbiology." Development and Testing of a Bacterial Biosensor for Toluene-Based Environmental Contaminants. Web. 12 Mar. 2012. <http://aem.asm.org/content/64/3/1006.full>. [5] "xylr." National Center for Biotechnology Information. U.S. National Library of Medicine. Web. 8 Mar. 2012. <http://www.ncbi.nlm.nih.gov/gene/?term=1218757>. |