BME494s2013 Project Template: Difference between revisions
No edit summary |
No edit summary |
||
Line 45: | Line 45: | ||
<br><br><br><br><br><br><br><br> | <br><br><br><br><br><br><br><br><br><br><br><br> | ||
<!-- These are lines breaks for spacing purposes. You can add or delete these as needed --> | <!-- These are lines breaks for spacing purposes. You can add or delete these as needed --> | ||
== | ==Genetic Switch Designs== | ||
<!--Delete the line items that do not apply to your project --> | <!--Delete the line items that do not apply to your project --> | ||
'''OUR GENE SWITCH''': | |||
<!-- Show a network/ circuit diagram of your team's Lac switch. Include a paragraph to explain how it works --> | |||
* '''Key Pre-existing Part''': We are currently using biobrick parts that was used for a similar project. The Pu and Pr promoters was created by the Michigan 2009 iGEM team. Because the projects are very similar, we hope to differentiate our project in the long-term by incorporating our constructed biobrick into a plant. When toulene or other aromatic compounds bind to the xylr protein, the plant would turn red. Right now, we are just testing our proof-of-concept in E.coli. | * '''Key Pre-existing Part''': We are currently using biobrick parts that was used for a similar project. The Pu and Pr promoters was created by the Michigan 2009 iGEM team. Because the projects are very similar, we hope to differentiate our project in the long-term by incorporating our constructed biobrick into a plant. When toulene or other aromatic compounds bind to the xylr protein, the plant would turn red. Right now, we are just testing our proof-of-concept in E.coli. | ||
Line 74: | Line 75: | ||
<br> | <br> | ||
==Testing== | <br><br><br><br><br><br><br><br><br><br><br><br> | ||
<!-- These are lines breaks for spacing purposes. You can add or delete these as needed --> | |||
==Building: Assembly Scheme== | |||
<!-- Illustrate and describe how you will build your lac switch. Incorporate information from Group Presentation 2 --> | |||
==Testing: Modeling and GFP Imaging== | |||
<br> | <br> |
Revision as of 14:43, 22 April 2013
Home People Course Projects Course Materials Schedule Photos Wiki Editing Help
Overview & Purpose
Background
Genetic Switch DesignsOUR GENE SWITCH:
Forward Primer :5'->GAATTCGCGGCCGCTTCTAG ATGTCGCTTACATACAAACC->3’
Building: Assembly SchemeTesting: Modeling and GFP Imaging
For our testing, we will examine the relationship between the level of concentration of the chemical compound toulene and the level of fluorescence. The fluorescence from DH5α cells harboring the constructed biobrick with the xylr protein will be measured at various concentrations of toluene.
For tuning our system, we hope to make it more effective by increasing the efficiency of the ribosome binding site. The RBS controls the accuracy and efficiency with which the translation of mRNA begins. Therefore, we hope to use this important variable to tune our system.
Human PracticesThe human practices of our project is important because it seeks to identify where these carcinogens are located in farmland areas. If these chemicals are getting into the groundwater, it poses an extreme risk to people in those areas. Problems of concern also involve the farmland animals, who eat the plants from the soil and drink the water. This is a serious issue because these chemicals get into the food that is produced. Our Team
Works Cited[1] "EARTHWORKS." EARTHWORKS. Web. 11 Mar. 2012. <http://www.earthworksaction.org/issues/detail/hydraulic_fracturing_101>. [2] "Team:Michigan/Project." IGEM 2009/Team Michigan:Project. Web. 12 Mar. 2012. <http://2009.igem.org/Team:Michigan/Project>. [3] "Water Contamination From Fracking (Hydraulic Fracturing)." Water Contamination From Shale. Web. 7 Mar. 2012. <http://www.water-contamination-from-shale.com/>. [4] "American Society for MicrobiologyApplied and Environmental Microbiology." Development and Testing of a Bacterial Biosensor for Toluene-Based Environmental Contaminants. Web. 12 Mar. 2012. <http://aem.asm.org/content/64/3/1006.full>. [5] "xylr." National Center for Biotechnology Information. U.S. National Library of Medicine. Web. 8 Mar. 2012. <http://www.ncbi.nlm.nih.gov/gene/?term=1218757>. |