BME494s2013 Project Template: Difference between revisions
No edit summary |
|||
Line 33: | Line 33: | ||
<br><br><br><br> | |||
<br><br><br><br><br><br><br><br> | |||
==Background== | ==Background== |
Revision as of 14:34, 22 April 2013
Home People Course Projects Course Materials Schedule Photos Wiki Editing Help
Overview & Purpose
BackgroundHydraulic fracturing or “fracking” is a way that allows for the retrieval of natural gases or oil from below the surface that were unsalvageable through the use of drilling. The process begins when a hole has been drilled into the surface containing the desired substance, and then a pipe with holes where the target substances are is placed into the cavity and flushed with fracturing fluid or gas, which cause the rock formations containing the natural resources to break. Once the surrounding earth crumbles due to the increasing pressure, the fracturing fluid flow is cut off and proppants (sand or ceramic beads) that were pumped in with the fracturing fluid hold the crevices open and the target materials flow up to the surface. Fracturing fluids that are commonly used include chemicals that can do a lot of harm due to their toxicity, such as diesel, which contains a lot of carcinogenic substances such as benzene and other dangerous materials like ethylbenzene, xylene and toluene. It has been observed that approximately 20 to 85 percent of these chemicals stay beneath the surface after they are pumped in and that these chemicals can then find their way into water sources which can result in harm to farms that use those water sources for their animals. [1]
Proof of Concept Design
Forward Primer :5'->GAATTCGCGGCCGCTTCTAG ATGTCGCTTACATACAAACC->3’
Testing
For our testing, we will examine the relationship between the level of concentration of the chemical compound toulene and the level of fluorescence. The fluorescence from DH5α cells harboring the constructed biobrick with the xylr protein will be measured at various concentrations of toluene.
For tuning our system, we hope to make it more effective by increasing the efficiency of the ribosome binding site. The RBS controls the accuracy and efficiency with which the translation of mRNA begins. Therefore, we hope to use this important variable to tune our system.
Human PracticesThe human practices of our project is important because it seeks to identify where these carcinogens are located in farmland areas. If these chemicals are getting into the groundwater, it poses an extreme risk to people in those areas. Problems of concern also involve the farmland animals, who eat the plants from the soil and drink the water. This is a serious issue because these chemicals get into the food that is produced. Our Team
Works Cited[1] "EARTHWORKS." EARTHWORKS. Web. 11 Mar. 2012. <http://www.earthworksaction.org/issues/detail/hydraulic_fracturing_101>. [2] "Team:Michigan/Project." IGEM 2009/Team Michigan:Project. Web. 12 Mar. 2012. <http://2009.igem.org/Team:Michigan/Project>. [3] "Water Contamination From Fracking (Hydraulic Fracturing)." Water Contamination From Shale. Web. 7 Mar. 2012. <http://www.water-contamination-from-shale.com/>. [4] "American Society for MicrobiologyApplied and Environmental Microbiology." Development and Testing of a Bacterial Biosensor for Toluene-Based Environmental Contaminants. Web. 12 Mar. 2012. <http://aem.asm.org/content/64/3/1006.full>. [5] "xylr." National Center for Biotechnology Information. U.S. National Library of Medicine. Web. 8 Mar. 2012. <http://www.ncbi.nlm.nih.gov/gene/?term=1218757>. |