Bcanton:Primers

From OpenWetWare

Revision as of 16:29, 14 December 2007 by Barry Canton (Talk | contribs)
(diff) ←Older revision | Current revision (diff) | Newer revision→ (diff)
Jump to: navigation, search

Tools

Template

'''Project''' -
'''Forward homology sequence''' - 5'--3'
'''Reverse homology sequence''' - 5'--3'
'''Reverse homology sequence reverse complement''' - 5'--3'
'''5' additions'''
'''Prefix''' - 5'--3'
'''Suffix''' - 5'--3'
'''Suffix reverse complement''' - 5'--3'
'''Forward primer''' - 5'--3'
'''Reverse primer''' - 5'--3'
'''Notes''' -

BioBrick prefixes and suffixes

  • BioBrick prefix - 5'-GAATTC GCGGCCGC T TCTAGA G-3'
  • BioBrick prefix for coding regions - 5'-GAATTC GCGGCCGC T TCTAG-3'
  • BioBrick suffix - 5'-TACTAGT A GCGGCCG CTGCAG-3'
  • BioBrick suffix reverse complement - 5'-CTGCAG CGGCCGC T ACTAGTA-3'

11/8/05

T7 gene 1 - To PCR T7 gene 1 from the T7 genome with BioBrick ends
Forward homology sequence - ATG AAC ACG ATT AAC ATC GCT AAG AAC GAC TTC 
Reverse homology sequence - 5'-TTA CGC GAA CGC GAA GTC CG-3'
I want to order it ready to cut X/P so that I can ligate downstream of a promoter-RBS
Prefix - 5'-CGC T TCTAG-3'
Suffix - 5'-TAC TAG TAG CGG CCG CTG CAG CTG G-3'
Suffix reverse complement - 5'-C CAG CTG CAG CGG CCG CTA CTA GTA-3'
T71F - 5'-CGCTTCTAG ATG AAC ACG ATT AAC ATC GCT AAG AAC GAC TTC-3' TM1 - 60C TM2 - 63C
T71R - 5'-C CAG CTG CAG CGG CCG CTA CTA GTA TTA CGC GAA CGC GAA GTC CG-3' TM1 - 60C TM2 - 72C
C0011 - ccdB - Biobricking the ccdB gene from E. coli.  Sequence from pDEST14(Invitrogen) courtesy of Heather
Forward homology sequence - 5'-ATG CAG TTT AAG GTT TAC ACC TAT AAA AGA GAG -3' Tm - 57C
Reverse homology sequence - 5'-CCA TTA ACC TGA TGT TCT GGG GAA TAT AA-3'
Reverse homology sequence reverse complement - 5'-TTA TAT TCC CCA GAA CAT CAG GTT AAT GG-3' Tm - 56.5C
5' additions - Will be cutting X/P
Prefix - 5'-CGC T TCTAG-3'
Suffix - 5'-TAC TAG TAG CGG CCG CTG CAG CTG G-3'
Suffix reverse complement - 5'-C CAG CTG CAG CGG CCG CTA CTA GTA-3'
C0011F - 5'-CGC T TCTAG ATG CAG TTT AAG GTT TAC ACC TAT AAA AGA GAG-3' Tm - 61.4C
C0011R - 5'-C CAG CTG CAG CGG CCG CTA CTA GTA TTA TAT TCC CCA GAA CAT CAG GTT AAT GG-3' Tm 69.1C
Notes - Just the usual biobrick homodimers
T7 Gene 5.3 - C7053 - 
Forward homology sequence - 5'-ATG AAC GAA AGA CAC TTA ACA GGT GC-3' Tm = 57.6C
Reverse homology sequence - 5'-GGC AAG AGA AAC AAA GGC ATA AAA CTA TAG-3'
Reverse homology sequence reverse complement - 5'-CTA TAG TTT TAT GCC TTT GTT TCT CTT GCC -3' Tm - 56.4C
5' additions
     Prefix - 5'-CGC T TCTAG-3'
GTTTCTT C GAATTC GCGGCCGC  T
Suffix - 5'-TAC TAG TAG CGG CCG CTG CAG CTG G-3'
Suffix reverse complement - 5'-C CAG CTG CAG CGG CCG CTA CTA GTA-3'
T75.3F - 5'-CGC T TCTAG ATG AAC GAA AGA CAC TTA ACA GGT GC-3' Tm - 62.6C
T75.3R - 5'-C CAG CTG CAG CGG CCG CTA CTA GTA CTA TAG TTT TAT GCC TTT GTT TCT CTT GCC-3' Tm- 69.2C
Notes - 
T75.3F2 - 5'- GTTTCTT C GAATTC GCGGCCGC T TCTAG ATG AAC GAA AGA CAC TTA ACA GGT GC-3' Tm - 62.6C
T7 Gene 7.7 - C7077 - 
Forward homology sequence - 5'-GTG GAA GAC TGC ATT GAA TGG AC-3' Tm = 56.3C
Reverse homology sequence - 5'-CAG CGT AAG ACA TGG AGA CAC ATT TA-3'
I'm missing an A here.  Reverse homology sequence should be - 5'-CAG CGT AAG ACA TGG AGA CAC ATT TAA-3'

Reverse homology sequence reverse complement - 5'-TAA ATG TGT CTC CAT GTC TTA CGC TG-3' Tm - 56.8C
This should be  Reverse homology sequence reverse complement - 5'-TTAA ATG TGT CTC CAT GTC TTA CGC TG-3' Tm - 56.8C
5' additions
Prefix - 5'-CGC T TCTAG-3'
Suffix - 5'-TAC TAG TAG CGG CCG CTG CAG CTG G-3'
Suffix reverse complement - 5'-C CAG CTG CAG CGG CCG CTA CTA GTA-3'
T77.7F - 5'-CGC T TCTAG GTG GAA GAC TGC ATT GAA TGG AC-3' Tm - 63.2C
T77.7R - 5'-C CAG CTG CAG CGG CCG CTA CTA GTA TAA ATG TGT CTC CAT GTC TTA CGC TG-3' Tm - 69.7C
This should be -  T77.7R -    5'-C CAG CTG CAG CGG CCG CTA CTA GTA T TAA ATG TGT CTC CAT GTC TTA CGC TG-3' Tm - 69.7C
Notes -
T77.7F2 - 5'-GTTTCTT C GAATTC GCGGCCGC T TCTAG GTG GAA GAC TGC ATT GAA TGG AC-3' Tm - 63.2C
R2182 - 
Forward homology sequence - 5'-cgcttctagagtaatacgtctcactatagggagatactagagtcacacaggaaagtactagtagcggccgctgcagCTGG-3'
Reverse homology sequence - 3'-CTTAAGCGCCGGCGAAGATCTCATTATGCAGAGTGATATCCCTCTATGATCTCAGTGTGTCCTTTCATGATCATCGCCGGCGACGTCGACC-5'
Reverse homology sequence reverse complement - 5'-CCAGCTGCAGCGGCCGCTACTAGTACTTTCCTGTGTGACTCTAGTATCTCCCTATAGTGAGACGTATTACTCTAGAAGCGGCCGCGAATTC-3'
5' additions - Already ready to be cut X/P
Prefix - 5'--3'
Suffix - 5'--3'
Suffix reverse complement - 5'--3'
R2182F - 5'--3'
R2182R - 5'--3'
Notes -
R6182 - 
Forward homology sequence - 5'-gaattcgcggccgcttctagagtaatacgtctcactatagggagatactagaggtgtgtactagtagcggccgctgcagCTGG-3'
Reverse homology sequence - 3'-CTTAAGCGCCGGCGAAGATCTCATTATGCAGAGTGATATCCCTCTATGATCTCCACACATGATCATCGCCGGCGACGTCGACC-5'
Reverse homology sequence reverse complement - 5'-CCAGCTGCAGCGGCCGCTACTAGTACACACCTCTAGTATCTCCCTATAGTGAGACGTATTACTCTAGAAGCGGCCGCGAATTC-3'
5' additions - Already ready to be cut X/P
Prefix - 5'--3'
Suffix - 5'--3'
Suffix reverse complement - 5'--3'
R6182F - 5'--3'
R6182R - 5'--3'
Notes -

11/14/05

PCR conditions

  • C0011 - 51C & 56C
  • C7053 - 51C & 57C
  • C7077 - 51C & 57/58C
  • Gene 1 - 55C 58C

12/6/05

Project - B0037                
Forward homology sequence - 5'-aattcgcggccgcttctagaggtgtgtctagta-3'
Reverse homology sequence - 5'-CTAGTACTAGACACACCTCTAGAAGCGGCCGCG-3'
Reverse homology sequence reverse complement - 5'--3'
5' additions already cut E/S
Prefix - 5'--3'
Suffix - 5'--3'
Suffix reverse complement - 5'--3'
Forward primer - 5'-aattcgcggccgcttctagaggtgtgtctagta-3'
Reverse primer - 5'-CTAGTACTAGACACACCTCTAGAAGCGGCCGCG-3'
Notes - 
Project - R8237                
Forward homology sequence - 5'-aattcgcggccgcttctagagtaatacgtctcactatagggagatactagaggtgtgtctagta-3'
Reverse homology sequence - 5'-CTAGTACTAGACACACCTCTAGTATCTCCCTATAGTGAGACGTATTACTCTAGAAGCGGCCGCG-3'
Reverse homology sequence reverse complement - 5'--3'
5' additions already cut E/S
Prefix - 5'--3'
Suffix - 5'--3'
Suffix reverse complement - 5'--3'
Forward primer - 5'-aattcgcggccgcttctagagtaatacgtctcactatagggagatactagaggtgtgtctagta-3'
Reverse primer - 5'-CTAGTACTAGACACACCTCTAGTATCTCCCTATAGTGAGACGTATTACTCTAGAAGCGGCCGCG-3'
Notes - 
Project - R4037 
Forward homology sequence - 5'-aattcgcggccgcttctagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagaggtgtgtctagta-3'
Reverse homology sequence - 5'-CTAGTACTAGACACACCTCTAGTAGTGCTCAGTATCTCTATCACTGATAGGGATGTCAATCTCTATCACTGATAGGGACTCTAGAAGCGGCCGCG-3'
Reverse homology sequence reverse complement - 5'--3'
5' additions
Prefix - 5'--3'
Suffix - 5'--3'
Suffix reverse complement - 5'--3'
Forward primer - 5'-aattcgcggccgcttctagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagaggtgtgtctagta-3'
Reverse primer - 5'-CTAGTACTAGACACACCTCTAGTAGTGCTCAGTATCTCTATCACTGATAGGGATGTCAATCTCTATCACTGATAGGGACTCTAGAAGCGGCCGCG-3'
Notes -

1/26/06

Project - E71101
Forward homology sequence - 5'-TAC TAG ATG CGT AAA GGA GAA GAA CTT TTC -3' Tm = 56.4C
Reverse homology sequence - 5'--3'
Reverse homology sequence reverse complement - 5'-CTG CAG CGG CCG CTA CTA G-3' Tm = 60.9C
5' additions
Prefix - 5'-cctttctagagtaatacgtctcactatagggagatactagaggtgtgtctag-3' (add an XbaI site and the promoter and RBS)
Suffix - 5'-GTT TCT CC-3' (adds random bases and extra bases to allow PstI to cut)
Suffix reverse complement - 5'--3'
E71101F - 5'-cctttctagagtaatacgtctcactatagggagatactagaggtgtgtctagTAC TAG ATG CGT AAA GGA GAA GAA CTT TTC-3' Tm = 67.1C
E71101R - 5'-GTT TCT CCCTG CAG CGG CCG CTA CTA G-3' Tm = 66.1C
Notes -

Project - E70101

Forward homology sequence - 5'-TAC TAG ATG CGT AAA GGA GAA GAA CTT TTC -3' Tm = 56.4C (same as above)
Reverse homology sequence - 5'--3'
Reverse homology sequence reverse complement - 5'-CTG CAG CGG CCG CTA CTA G-3' Tm = 60.9C
5' additions
Prefix - 5'-cctttctagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagaggtgtgtctag-3' (add an XbaI site and the promoter and RBS)
Suffix - 5'-GTT TCT CC-3' (adds random bases and extra bases to allow PstI to cut)
Suffix reverse complement - 5'--3'
E70101F - 5'-cctttctagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagaggtgtgtctagTAC TAG ATG CGT AAA GGA GAA GAA CTT TTC-3' Tm = 69.0C (
E70101R - 5'-GTT TCT CCCTG CAG CGG CCG CTA CTA G-3' Tm = 66.1C
Notes - this is 113 bases and I can't reduce it by 13 bases.  So I should get E71101 sorted and then just PCR R0040 onto that, which would save me having to include B0037

3/3/06

Project - E70102-annealing
Forward homology sequence -  5'-aattcgcggccgcttctagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtctcacgtgtgtcaagta-3' 
Reverse homology sequence -  5'-CTAGTActtgacacacgtgagaCTCTAGTAGTGCTCAGTATCTCTATCACTGATAGGGATGTCAATCTCTATCACTGATAGGGACTCTAGAAGCGGCCGCG-3' 
Reverse homology sequence reverse complement - 5'--3'
5' additions
Prefix - 5'--3'
Suffix - 5'--3'
Suffix reverse complement - 5'--3'
Forward primer - 5'-aattcgcggccgcttctagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtctcacgtgtgtcaagta-3'
Reverse primer - 5'-CTAGTActtgacacacgtgagaCTCTAGTAGTGCTCAGTATCTCTATCACTGATAGGGATGTCAATCTCTATCACTGATAGGGACTCTAGAAGCGGCCGCG-3'
Notes - I put this together by just copying R4037 from above and then replacing with the B0070 sequences.  Its 101 bases so I can't order it.
Project - E70103-annealing
Forward homology sequence - 5'-aattcgcggccgcttctagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtctcacgtgtgtta-3'
Reverse homology sequence - 5'-CTAGTAacacacgtgagaCTCTAGTAGTGCTCAGTATCTCTATCACTGATAGGGATGTCAATCTCTATCACTGATAGGGACTCTAGAAGCGGCCGCG-3'
Reverse homology sequence reverse complement - 5'--3'
5' additions
Prefix - 5'--3'
Suffix - 5'--3'
Suffix reverse complement - 5'--3'
Forward primer - 5'-aattcgcggccgcttctagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtctcacgtgtgtta-3'
Reverse primer - 5'-CTAGTAacacacgtgagaCTCTAGTAGTGCTCAGTATCTCTATCACTGATAGGGATGTCAATCTCTATCACTGATAGGGACTCTAGAAGCGGCCGCG-3'
Notes -

3/20/06

Project - E71102
Forward homology sequence - 5'-gtttctccgaattcgcggccgcttctagag taatacgtctcactatagggaga tactagagtctcacgtgtgtcaagta-3' 
Reverse homology sequence - 5'- TACTTGACACACGTGAGACTCTAGTATCTCCCTATAGTGAGACGTATTACTCTAGAAGCGGCCGCGAATTCGGAGAAAC -3'
Reverse homology sequence reverse complement - 5'--3'
5' additions
Prefix - 5'--3'
Suffix - 5'--3'
Suffix reverse complement - 5'--3'
Forward primer - 5'--3'
Reverse primer - 5'--3'
5'-gtttctccgaattcgcggccgcttctagag taatacgtctcactatagggaga tactagagtctcacgtgtgtcaagta-3'
3'-CAAAGAGGCTTAAGCGCCGGCGAAGATCTC ATTATGCAGAGTGATATCCCTCT ATGATCTCAGAGTGCACACAGTTCAT-5'
5'-    ctccgaattcgcggccgcttctagag taatacgtctcactatagggaga tac-3'
    3'-                                GCAGAGTGATATCCCTCT ATGATCTCAGAGTGCACACAGTTCATGATCATCGC-5'
                                    5'-CGCTACTAGTACTTGACA CACGTGAGACTCTAGTATCTCCCTATAGTGAGACG -E71102Rnew
                                       GCAGAGTGATATCCCTCT ATGATCTCAGAGTGCACACAGTTCATCGCTACTAT
                               5'- TATCATCGCTACTTGACACACGTGAGACTCTAGTATCTCCCTATAGTGAGACG -3'
Notes -
Project - E71104
Forward homology sequence - 5'-gtttctccgaattcgcggccgcttctagag tcatacgactcactatagggaga tactagagtctcacgtgtgtcaagta-3'
Reverse homology sequence - 5'--3'
Reverse homology sequence reverse complement - 5'--3'
5' additions
Prefix - 5'--3'
Suffix - 5'--3'
Suffix reverse complement - 5'--3'
Forward primer - 5'--3'
Reverse primer - 5'--3'
Notes -
5'-gtttctccgaattcgcggccgcttctagag tcatacgactcactatagggaga tactagagtctcacgtgtgtcaagta-3'
3'-CAAAGAGGCTTAAGCGCCGGCGAAGATCTC AgTATGCTGAGTGATATCCCTCT ATGATCTCAGAGTGCACACAGTTCAT-5'
5'-ctccgaattcgcggccgcttctagag tcatacgactcactatagggaga tac-3'
3'-                                GCTGAGTGATATCCCTCT ATGATCTCAGAGTGCACACAGTTCATGATCATCGC-5'
                                5'-CGCTACTAGTACTTGACACACGTGAGACTCTAGTATCTCCCTATAGTGAGTCG-3' -E71104Rnew
                               5'- TATCATCGCTACTTGACACACGTGAGACTCTAGTATCTCCCTATAGTGAGTCG -3'
So the reverse primer is the same except for one base:)
Personal tools