
From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 7: Line 7:
| ca997F || EIPCR for Biobrick p15A/CmR plasmid || ctcgaGGATCCTGCAGctagaaatattttatctgatt || BamHI,PstI
| ca997F || EIPCR for Biobrick p15A/CmR plasmid || ctcgaGGATCCTGCAGctagaaatattttatctgatt || BamHI,PstI
|ca998 || Forward Sequencing of pSB1A2 || gtatcacgaggcagaatttcag
|ca999 || Reverse sequencing of pSB1A2 || ccgtattaccgcctttgagtg
|2005iGEM42 || gfp_f1 || GCGGCGGGTACCCAGAACT

Revision as of 16:26, 7 June 2006

Name Description Sequence Sites
ca997F EIPCR for Biobrick p15A/CmR plasmid ctcgaGGATCCTGCAGctagaaatattttatctgatt BamHI,PstI
ca998 Forward Sequencing of pSB1A2 gtatcacgaggcagaatttcag
ca999 Reverse sequencing of pSB1A2 ccgtattaccgcctttgagtg
Personal tools