
From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 1: Line 1:
Return to [ main page]
{| border="1" cellpadding="2"
{| border="1" cellpadding="2"

Revision as of 00:52, 8 June 2006

Return to main page

Name Description Sequence Sites
ca997F EIPCR for Biobrick p15A/CmR plasmid ctcgaGGATCCTGCAGctagaaatattttatctgatt BamHI,PstI
ca998 Forward Sequencing of pSB1A2 gtatcacgaggcagaatttcag
ca999 Reverse sequencing of pSB1A2 ccgtattaccgcctttgagtg
Personal tools