
From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 14: Line 14:
|ca999 || Reverse sequencing of pSB1A2 || ccgtattaccgcctttgagtg
|ca999 || Reverse sequencing of pSB1A2 || ccgtattaccgcctttgagtg
|2005iGEM1 || RlamFwd || caatcacgcgcaccccccggccgttttagcggctaaaaaagtcatgtgtaggctggagctgcttc
|2005iGEM2 || RlamRev || acagcagggaagcagcgcttttccgctgcataaccctgcttcgggatgggaattagccatggtcc
Line 22: Line 22:
|2005iGEM5 || TraJF-BBRev || CACGAACTGCAGCGGCCGCTACTAGTAttaacgcgtatttatgatacacatagc
Line 32: Line 32:
|2005iGEM10 || TraJF-BBFor || gcagcaGAATTCGCGGCCGCTTCTAGAGatgtatccgatggatcgtattcaac
|2005iGEM11 || TraJR-BBRev || CACGAACTGCAGCGGCCGCTACTAGTAtcatggctctgccctcg
|2005iGEM12 || TraJR-BBFor || gcagcaGAATTCGCGGCCGCTTCTAGAGatggctgatgaaaccaagcc
Line 50: Line 50:
|2005iGEM19 || FORlamF || tttatccgtaaataatttaacccactccacaaaaaggctcaacag gtgtaggctggagctgcttc
|2005iGEM20 || FORlamR || ggaccatggctaattcccat ctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaa
Line 86: Line 86:
Line 98: Line 98:
|2005iGEM42 || gfp_f1 || GCGGCGGGTACCCAGAACT
|2005iGEM42 || gfp_f1 || GCGGCGGGTACCCAGAACT

Revision as of 18:16, 9 June 2006

Return to main page

Name Description Sequence Sites
ca997F EIPCR for Biobrick p15A/CmR plasmid ctcgaGGATCCTGCAGctagaaatattttatctgatt BamHI,PstI
ca998 Forward Sequencing of pSB1A2 gtatcacgaggcagaatttcag
ca999 Reverse sequencing of pSB1A2 ccgtattaccgcctttgagtg
2005iGEM1 RlamFwd caatcacgcgcaccccccggccgttttagcggctaaaaaagtcatgtgtaggctggagctgcttc
2005iGEM2 RlamRev acagcagggaagcagcgcttttccgctgcataaccctgcttcgggatgggaattagccatggtcc
2005iGEM5 TraJF-BBRev CACGAACTGCAGCGGCCGCTACTAGTAttaacgcgtatttatgatacacatagc
2005iGEM10 TraJF-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatgtatccgatggatcgtattcaac
2005iGEM12 TraJR-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatggctgatgaaaccaagcc
2005iGEM19 FORlamF tttatccgtaaataatttaacccactccacaaaaaggctcaacag gtgtaggctggagctgcttc
2005iGEM20 FORlamR ggaccatggctaattcccat ctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaa
Personal tools