Berk2006-Oligos

From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 38: Line 38:
|2005iGEM12 || TraJR-BBFor || gcagcaGAATTCGCGGCCGCTTCTAGAGatggctgatgaaaccaagcc
|2005iGEM12 || TraJR-BBFor || gcagcaGAATTCGCGGCCGCTTCTAGAGatggctgatgaaaccaagcc
|-
|-
-
|2005iGEM13 || FTJiamR || CAGAAAAGACGGAAAGTCTATATTTTAT...
+
|2005iGEM13 || FTJiamR || CAGAAAAGACGGAAAGTCTATATTTTATTAACACCTTATTAACGCG ATGGGAATTAGCCATGGTCC
|-
|-
|2005iGEM14 || OriT-R-Rev || TTTTCCGCTGCATAACCCTGC
|2005iGEM14 || OriT-R-Rev || TTTTCCGCTGCATAACCCTGC
Line 48: Line 48:
|2005iGEM17 || OriT-R-For || GCCGCCTTTTCCTCAATCG
|2005iGEM17 || OriT-R-For || GCCGCCTTTTCCTCAATCG
|-
|-
-
|2005iGEM18 || FTJiamF || GGTGACAGTACGAAAGATAATTAGTATA...
+
|2005iGEM18 || FTJiamF || ggtgacagtacgaaagataattagtatattaattacgtggttaat gtgtaggctggagctgcttc
|-
|-
|2005iGEM19 || FORlamF || tttatccgtaaataatttaacccactccacaaaaaggctcaacag gtgtaggctggagctgcttc
|2005iGEM19 || FORlamF || tttatccgtaaataatttaacccactccacaaaaaggctcaacag gtgtaggctggagctgcttc
Line 92: Line 92:
|2005iGEM39 || Predreverse || TCGACTTCTGCAGCGGCCGCTACTAGTA...
|2005iGEM39 || Predreverse || TCGACTTCTGCAGCGGCCGCTACTAGTA...
|-
|-
-
|2005iGEM40 || RpoEreverse || TCGACTTCTGCAGCGGCCGCTACTAGTA...
+
|2005iGEM40 || RpoEreverse || TCGACTTCTGCAGCGGCCGCTACTAGTATCAACTCATATGCTGGCGCAGACG
|-
|-
|2005iGEM41 || gfp_r || GCGGCGAAGCTTTTCCATGCC
|2005iGEM41 || gfp_r || GCGGCGAAGCTTTTCCATGCC

Revision as of 19:35, 9 June 2006

Return to main page


Name Description Sequence Sites
ca997F EIPCR for Biobrick p15A/CmR plasmid ctcgaGGATCCTGCAGctagaaatattttatctgatt BamHI,PstI
ca998 Forward Sequencing of pSB1A2 gtatcacgaggcagaatttcag
ca999 Reverse sequencing of pSB1A2 ccgtattaccgcctttgagtg
2005iGEM1 RlamFwd caatcacgcgcaccccccggccgttttagcggctaaaaaagtcatgtgtaggctggagctgcttc
2005iGEM2 RlamRev acagcagggaagcagcgcttttccgctgcataaccctgcttcgggatgggaattagccatggtcc
2005iGEM3 TraJ-F-Rev TTAACGCGTATTTATGATACACATAGC
2005iGEM4 TraJ-F-For ATGTATCCGATGGATCGTATTCAAC
2005iGEM5 TraJF-BBRev CACGAACTGCAGCGGCCGCTACTAGTAttaacgcgtatttatgatacacatagc
2005iGEM6 FCtra-rev CCATAGATATTCCCTGCCCTG
2005iGEM7 FCtra-fwd CTCAGTCCTCATGTCTCCGG
2005iGEM8 OriTBackwardBB CATTAGAGATTACCTTTTTTGAAC
2005iGEM9 oriTforwardF AAGGCTCAACAGGTTGGTGGTTC
2005iGEM10 TraJF-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatgtatccgatggatcgtattcaac
2005iGEM11 TraJR-BBRev CACGAACTGCAGCGGCCGCTACTAGTAtcatggctctgccctcg
2005iGEM12 TraJR-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatggctgatgaaaccaagcc
2005iGEM13 FTJiamR CAGAAAAGACGGAAAGTCTATATTTTATTAACACCTTATTAACGCG ATGGGAATTAGCCATGGTCC
2005iGEM14 OriT-R-Rev TTTTCCGCTGCATAACCCTGC
2005iGEM15 TraJ-R-For ATGGCTGATGAAAGCAAGCC
2005iGEM16 TraJ-R-Rev TCATGGCTCTGCCTCG
2005iGEM17 OriT-R-For GCCGCCTTTTCCTCAATCG
2005iGEM18 FTJiamF ggtgacagtacgaaagataattagtatattaattacgtggttaat gtgtaggctggagctgcttc
2005iGEM19 FORlamF tttatccgtaaataatttaacccactccacaaaaaggctcaacag gtgtaggctggagctgcttc
2005iGEM20 FORlamR ggaccatggctaattcccat ctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaa
2005iGEM21 tabbR CTGCAGCGGCCGCTACTAGTAATTATAG...
2005iGEM22 tabb1R CTGCAGCGGCCGCTACTAGTATCTGCAG...
2005iGEM23 tabb2R CTGCAGCGGCCGCTACTAGTAATAACGT...
2005iGEM24 crbb1R CTGCAGCGGCCGCTACTAGTATCTCCTC...
2005iGEM25 crbb2R CTGCAGCGGCCGCTACTAGTATCTCCTC...
2005iGEM26 tabb2F GAATTCGCGGCCGCTTCTAGAGACCCAA...
2005iGEM27 crR12wBBR AGCAGCCTGCAGCGGCCGCTACTAGTAG...
2005iGEM28 rrnBP1F GCAGCAGAATTCGCGGCCGCTTCTAGAG...
2005iGEM29 crbb2F GAATTCCGGCCGCTTCTAGAGAACTAG...
2005iGEM30 rrnBP1R AGCAGCCTGCAGCGGCCGCTACTAGTAG...
2005iGEM31 crR12wBBF GCAGCAGAATTCGCGGCCGCTTCTAGAG...
2005iGEM32 Vlad-fwd ATACTCGAGATGGCGAGCAGTGAGGACA...
2005iGEM33 vlad-rev ATAGAATTCTACAGGAAGAGGTGGTGG
2005iGEM34 crbb1F GAATTCGCGGCCGCTTCTAGAGAACTAG...
2005iGEM35 tabbF GAATTCGCGGCCGCTTCTAGAGAGAAAA...
2005iGEM36 tabbF GAATTCGCGGCCGCTTCTAGAGACCCAA...
2005iGEM37 ChrrF GCAGCAGAATTCGCGGCCGCTTCTAGAGATGACGATCCGGCACCATGT
2005iGEM38 ChrR Reverse CACGAACTGCAGCGGCCGCTACTAGTATCAGATGCGGAAGAAGGGCT
2005iGEM39 Predreverse TCGACTTCTGCAGCGGCCGCTACTAGTA...
2005iGEM40 RpoEreverse TCGACTTCTGCAGCGGCCGCTACTAGTATCAACTCATATGCTGGCGCAGACG
2005iGEM41 gfp_r GCGGCGAAGCTTTTCCATGCC
2005iGEM42 gfp_f1 GCGGCGGGTACCCAGAACT
2005iGEM43 RpoEforward CCTAGGAATTCGCGGCCGCTTCTAGAGGTGACGGACAAGAGTGACAGGAC
2005iGEM44 RpoEp1reverse TCGACTTCTGCAGCGGCCGCTACTAGTACCGCCCGGAGGTGAAGATAG
2005iGEM45 RpoEp1forward CCTAGGAATTCGCGGCCGCTTCTAGAGTTTTTCCCGCCTCCCGCCTG
2005iGEM46 spoIIEreverse TCGACTTCTGCAGCGGCCGCTACTAGTATCCTCTCATCTCCCACCTGTTATAT
2005iGEM47 SpoIIEforward CCTAGGAATTCGCGGCCGCTTCTAGAGCGGGTCATCCTAACAAATCGGTTTC
2005iGEM48 BPredForrward CCTAGGAATTCGCGGCCGCTTCTAGAGATGGCGAGCAGTGAGGACATCATC
Personal tools