
From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Line 109: Line 109:
|ca1000 || Forward sequencing of pSB3C6 (pAC997) || cagggcagggtcgttaaatagc
|ca1001 || Reverse sequencing of pSB3C6 (pAC997) || ggcggttttttcgttttcagagc
|BBa_G00101 || Reverse sequencing of pSB1A* plasmids || attaccgcctttgagtgagc
|ca1002F || Forward EcoRI oligo to make XbaI blunter cassette || cttctggaattcgcggccgcaactagtgtccctatcag
|ca1002R || Reverse PstI oligo to make SpeI blunter cassette || gaagcctgcagcggccgctTctagAatataaacgcag
|name || description || sequence
|name || description || sequence

Revision as of 16:31, 22 June 2006

Return to main page

Name Description Sequence Sites
ca997F EIPCR for Biobrick p15A/CmR plasmid ctcgaGGATCCTGCAGctagaaatattttatctgatt BamHI,PstI
ca998 Forward Sequencing of pSB1A2 gtatcacgaggcagaatttcag
ca999 Reverse sequencing of pSB1A2 ccgtattaccgcctttgagtg
2005iGEM1 RlamFwd caatcacgcgcaccccccggccgttttagcggctaaaaaagtcatgtgtaggctggagctgcttc
2005iGEM2 RlamRev acagcagggaagcagcgcttttccgctgcataaccctgcttcgggatgggaattagccatggtcc
2005iGEM5 TraJF-BBRev CACGAACTGCAGCGGCCGCTACTAGTAttaacgcgtatttatgatacacatagc
2005iGEM10 TraJF-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatgtatccgatggatcgtattcaac
2005iGEM12 TraJR-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatggctgatgaaaccaagcc
2005iGEM18 FTJiamF ggtgacagtacgaaagataattagtatattaattacgtggttaat gtgtaggctggagctgcttc
2005iGEM19 FORlamF tttatccgtaaataatttaacccactccacaaaaaggctcaacag gtgtaggctggagctgcttc
2005iGEM20 FORlamR ggaccatggctaattcccat ctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaa
ca1000 Forward sequencing of pSB3C6 (pAC997) cagggcagggtcgttaaatagc
ca1001 Reverse sequencing of pSB3C6 (pAC997) ggcggttttttcgttttcagagc
BBa_G00101 Reverse sequencing of pSB1A* plasmids attaccgcctttgagtgagc
ca1002F Forward EcoRI oligo to make XbaI blunter cassette cttctggaattcgcggccgcaactagtgtccctatcag
ca1002R Reverse PstI oligo to make SpeI blunter cassette gaagcctgcagcggccgctTctagAatataaacgcag
name description sequence
name description sequence
Personal tools