
From OpenWetWare

(Difference between revisions)
Jump to: navigation, search
Current revision (00:14, 22 November 2006) (view source)
(20 intermediate revisions not shown.)
Line 1: Line 1:
Return to [ main page]
Return to [ main page]
{| border="1" cellpadding="2"
{| border="1" cellpadding="2" <tt>
| ca997F || EIPCR for Biobrick p15A/CmR plasmid || ctcgaGGATCCTGCAGctagaaatattttatctgatt || BamHI,PstI
|ca998 || Forward Sequencing of pSB1A2 || gtatcacgaggcagaatttcag
|ca999 || Reverse sequencing of pSB1A2 (fails, don't use) || ccgtattaccgcctttgagtg
|2005iGEM1 || RlamFwd || caatcacgcgcaccccccggccgttttagcggctaaaaaagtcatgtgtaggctggagctgcttc
|2005iGEM1 || RlamFwd || caatcacgcgcaccccccggccgttttagcggctaaaaaagtcatgtgtaggctggagctgcttc
Line 20: Line 13:
|-|2005iGEM5 || TraJF-BBRev || CACGAACTGCAGCGGCCGCTACTAGTAttaacgcgtatttatgatacacatagc
|2005iGEM5 || TraJF-BBRev || CACGAACTGCAGCGGCCGCTACTAGTAttaacgcgtatttatgatacacatagc
Line 108: Line 100:
|BBa_G00101 || Reverse sequencing of pSB1A* plasmids || attaccgcctttgagtgagc
|ca850R || Reverse EcoRI for FRT-Kan-Frt at P1 || cacttGAATTCgtgtaggctggagctgcttc
|ca997F || EIPCR for Biobrick p15A/CmR plasmid || ctcgaGGATCCTGCAGctagaaatattttatctgatt
|ca998 || Forward Sequencing of pSB1A2 || gtatcacgaggcagaatttcag
|ca999 || Reverse sequencing of pSB1A2 (fails, don't use) || ccgtattaccgcctttgagtg
|ca1000 || Forward sequencing of pSB3C6 (pAC997) || cagggcagggtcgttaaatagc
|ca1000 || Forward sequencing of pSB3C6 (pAC997) || cagggcagggtcgttaaatagc
Line 113: Line 117:
|ca1001 || Reverse sequencing of pSB3C6 (pAC997) || ggcggttttttcgttttcagagc
|ca1001 || Reverse sequencing of pSB3C6 (pAC997) || ggcggttttttcgttttcagagc
|BBa_G00101 || Reverse sequencing of pSB1A* plasmids || attaccgcctttgagtgagc
|ca1002F || Forward EcoRI oligo to make XbaI blunter cassette || cttctggaattcgcggccgcaactagtgtccctatcag
|ca1002R || Reverse PstI oligo to make SpeI blunter cassette || gaagcctgcagcggccgctTctagAatataaacgcag
|ca1002F || Forward EcoRI oligo to make XbaI blunter cassette || cttctggaattcgcggccgcaactagtgtccctatcag
|ca1002F || Forward EcoRI oligo to make XbaI blunter cassette || cttctggaattcgcggccgcaactagtgtccctatcag
Line 119: Line 126:
|ca1002R || Reverse PstI oligo to make SpeI blunter cassette || gaagcctgcagcggccgctTctagAatataaacgcag
|ca1002R || Reverse PstI oligo to make SpeI blunter cassette || gaagcctgcagcggccgctTctagAatataaacgcag
|ca1010F || Forward (universal biobrick) EcoRI for FRT || GGACTgaattcgcggccgcttctagag
|ca1010R || Reverse SpeI oligo for FRT || cctatactagtagaagttcctattctctaAaaagtataggaacttcctctagaagcggccgcg
|ca1016F || Forward EcoRI to biobrick CAT of pKD3 || gacttgaattcgcggccgcttctagaggaataggaacttcatttaaatg
|ca1016R || Reverse SpeI to biobrick CAT of pKD3 || ccgctactagtggcgcgcctacctgtgacgg
|ca1020F || Forward SpeI oligo for X-rbsRFP-P plasmid || gcactACTAGTgaaagaggagaaatactagatggc
|ca1020R || Reverse PstI oligo for X-rbsRFP-P plasmid || ccggactgcagcggccgcttctagtatataaacg
|ca1025F || Forward quickchange for GFP[S56AGGA] || gaaacagcatgactttttcaagAGGAgccatgcccgaaggttatgtac
|ca1025R || Reverse quickchange for GFP[S56AGGA] || gtacataaccttcgggcatggcTCCTcttgaaaaagtcatgctgtttc
|ca1027R || Reverse SpeI to fix lock3 variant rbs spacing || gaagccaactagtatttctcctctt
|ca1028F || Forward XbaI to extend lock3 variants || gcatgTCTAGAGtgtagaccgAACTAGAATCACCTCTTGC
|ca1029R || Reverse oligo for Pcon || gacttActagtaGCTAGCattataCCTAGGactgaGCTAGCtgtcaactctagAAGCGGCCGCGAA
|KB001 || Forward EcoRI to construct Ptet part-making biobrick plasmid || ttctggaattcgcggccgcaactagagccaggcatc
|KB001 || Forward EcoRI to construct Ptet part-making biobrick plasmid || ttctggaattcgcggccgcaactagagccaggcatc
Line 136: Line 166:
|KB008 || Reverse PstI oligo for part 3d || ctgcaggcggccgctactagtacgggcgggcgggcgggcgggaagctttttttttttAACTAGAATCACCTCTT
|KB008 || Reverse PstI oligo for part 3d || ctgcaggcggccgctactagtacgggcgggcgggcgggcgggaagctttttttttttAACTAGAATCACCTCTT
|KB009 || Forward Ptet screening oligo || tccctatcagtgatagagat
|KB010 || Forward Lock2 screening oligo || aactagaatcacctctagtg
|KB011 || Forward mRFP1 screening oligo || atggcttcctccgaagacgt
|KB012 || KB009 5' add on || CACTGTctagAgcgggcgggcgggc
|KB013 || KB010 3' add on || CCAAActgcaggcggccgctactag
|KB014 || Lock3 4 base add-on to 3' end of hairpin loop forward oligo || GTCGATCTAGAGAACTAGAATCACCTCTTGCTTTTGGGTAAGAC
|KB015 || Lock3 1 base add-on to 3' end of hairpin loop reverse oligo || CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTGTCTTACCCAAAAGCAAGAG
|KB016 || Lock3 2 base add-on to 3' end of hairpin loop reverse oligo || CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTCGTCTTACCCAAAAGCAAGAG
|KB017 || Lock3 4 base add-on to 3' end of hairpin loop reverse oligo || CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTCTGTCTTACCCAAAAGCAAGAG
|KB018 || Lock3 one point mutation on the 5' end of the 3' homology region forward oligo || GTCGATCTAGAGAACTAGAATCAACTCTTGCTTTTGGGTAAGAAAGAGG
|KB019 || Lock3 one point mutation on the 5' end of the 3' homology region reverse oligo || CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTTCTTACCCAAAAGC
|KB020 || Lock3 two consecutive point mutations on the 5' end of the 3' homology region forward oligo || GTCGATCTAGAGAACTAGAATCAATTCTTGCTTTTGGGTAAGAAAGAGG
|KB021 || Lock3 one point mutation on the 3' end of the 3' homology region forward oligo || GTCGATCTAGAGAACTAGAATCACCTCTAGCTTTTGGGTAAGAAAGAGG
|KB022 || Lock3 two consecutive point mutations on the 3' end of the 3' homology region forward oligo || GTCGATCTAGAGAACTAGAATCACCTCAAGCTTTTGGGTAAGAAAGAGG
|JL1 || Forward EcoRI to make spectinomycin resistance biobrick
|JL1 || Forward EcoRI to make spectinomycin resistance biobrick
Line 175: Line 233:
|JL15 || Reverse SpeI oligo to bioBrick trbC *internal PstI site|| gacttACTAGTcgtttcatttcccggaatctc
|JL15 || Reverse SpeI oligo to bioBrick trbC *internal PstI site|| gacttACTAGTcgtttcatttcccggaatctc
|KB009 || Forward Ptet screening oligo || tccctatcagtgatagagat
|JL16 || Forward trbC 20mers || gctggcgttaccagatggtg
|JL17 || Reverse trbC 20mers || gccctgaatactgctgcttcc
|JL18 || Forward TraG 20mers || ctgattatgttggtgcgctg
|Jl19 || Reverse TraG 20mers || cattcgatttccagtacaggc
|JL20 || Forward BglII to BamHI for traG-5' knockout cassette || GAGTCAGATCTgattatgttggtgcgctg
|JL21 || Reverse MfeI to EcoRI for traG-5' knockout cassette || gctggCAATTGcattcgatttccagtacaggc
|JL22 || Reverse EcoRI IPCR of traG || gctgcGAATTCgatactggaaggaatgggc
|KB010 || Forward Lock2 screening oligo || aactagaatcacctctagtg
|JL23 || Forward PstI IPCR of traG || cattgCTGCAGacggcagcattgaagaggcg
|KB011 || Forward mRFP1 screening oligo || atggcttcctccgaagacgt
|bh001|| forward XbaI oligo for RBS modification of J01022 || gatcgTCTAGAaaagaggagatactagATGgcttcctccgaa
|KB012 || KB009 5' add on || CACTGTctagAgcgggcgggcgggc
|bh002F|| forward extension oligo to construct J23082 || gatcgggatccATAAAAaagaggtgattctagttcggtct
|KB013 || KB010 3' add on || CCAAActgcaggcggccgctactag
|bh002R|| reverse extension oligo to construct J23082  || ctagcaagcttTTTTgtgtagaccgaactagaatcacctc
|JL16 || Forward trbC 20mers || gctggcgttaccagatggtg
|bh003F|| forward extension oligo to construct J23083 || gatcgggatccATAAAAaaagcaagaggtgattctagttc
|JL17 || Reverse trbC 20mers || gccctgaatactgctgcttcc
|KB014 || Lock3 4 base add-on to 3' end of hairpin loop forward oligo || GTCGATCTAGAGAACTAGAATCACCTCTTGCTTTTGGGTAAGAC
|bh003R|| reverse extension oligo to construct J23083 || catcgaagcttTTTTgaccgaactagaatcacctcttgct
|KB015 || Lock3 1 base add-on to 3' end of hairpin loop reverse oligo || CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTGTCTTACCCAAAAGCAAGAG
|bh004F|| forward extension oligo to construct J23084|| gatcgggatccATAAAAgtcttacccaaaagcaagaggtg
|KB016 || Lock3 2 base add-on to 3' end of hairpin loop reverse oligo || CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTCGTCTTACCCAAAAGCAAGAG
|bh004R|| reverse extension oligo to construct J23084 || cagctaagcttTTTTgaatcacctcttgcttttgggtaag
|KB017 || Lock3 4 base add-on to 3' end of hairpin loop reverse oligo || CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTCTGTCTTACCCAAAAGCAAGAG
|SIL01|| Forward BamH oligo to construct J23201 || GTCATggatccataaaacccaaaagcaagaggtgattc
|KB018 || Lock3 one point mutation on the 5' end of the 3' homology region forward oligo || GTCGATCTAGAGAACTAGAATCAACTCTTGCTTTTGGGTAAGAAAGAGG
|SIL02|| Reverse HindIII oligo to construct J23201 || GATACaagctttttaactagaatcacctcttgcttttg
|KB019 || Lock3 one point mutation on the 5' end of the 3' homology region reverse oligo || CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTTCTTACCCAAAAGC
|SIL03|| Forward BamH oligo to construct J23202 || GTCATggatccataaaaaacccaaaagcaagaggtgattc
|KB020 || Lock3 two consecutive point mutations on the 5' end of the 3' homology region forward oligo || GTCGATCTAGAGAACTAGAATCAATTCTTGCTTTTGGGTAAGAAAGAGG
|SIL04|| Reverse HindIII oligo to construct J23202 || GATACaagctttttttaactagaatcacctcttgcttttg
|KB021 || Lock3 one point mutation on the 3' end of the 3' homology region forward oligo || GTCGATCTAGAGAACTAGAATCACCTCTAGCTTTTGGGTAAGAAAGAGG
|SIL05|| Forward BamH oligo to construct J23203 || GTCATggatccataaaaaaaacccaaaagcaagaggtgattc
|KB022 || Lock3 two consecutive point mutations on the 3' end of the 3' homology region forward oligo || GTCGATCTAGAGAACTAGAATCACCTCAAGCTTTTGGGTAAGAAAGAGG
|SIL06|| Reverse HindIII oligo to construct J23203 || GATACaagctttttttttaactagaatcacctcttgcttttg
|SIL07|| Forward BamH oligo to construct J23204 || GTCATggatccataaaaaaaaaaaacccaaaagcaagaggtgattc
|SIL08|| Reverse HindIII oligo to construct J23204 || GATACaagctttttttttttttaactagaatcacctcttgcttttg
|SIL09|| Forward BamH oligo to construct J23205 || GTCATggatccataaaaaaaaaaaaaacccaaaagcaagaggtgattc
|SIL10|| Reverse HindIII oligo to construct J23205 || GATACaagctttttttttttttttaactagaatcacctcttgcttttg
|SIL11|| Forward BamH oligo to construct J23206 || GTCATggatccataaaaaaaaaaaaaaaacccaaaagcaagaggtgattc
|SIL12|| Reverse HindIII oligo to construct J23206 || GATACaagctttttttttttttttttaactagaatcacctcttgcttttg
|SIL13|| Forward BamH oligo to construct J23207|| GTCATggatccataaaaaaaaaaaaaaaaaacccaaaagcaagaggtgattc
|SIL14|| Reverse HindIII oligo to construct J23207 || GATACaagctttttttttttttttttttaactagaatcacctcttgcttttg
|SIL15|| Forward BamH oligo to construct J23208 || GTCATggatccataaaaaaaaaaaaaaaaaaaacccaaaagcaagaggtgattc
|SIL16|| Reverse HindIII oligo to construct J23208 || GATACaagctttttttttttttttttttttaactagaatcacctcttgcttttg
|bh005F|| forward extension oligo to construct j23098 || ggctaggatccATAAAAtgtcttacccaaaagcaagaggt
|bh005R|| reverse extension oligo to construct j23098 || ccgataagcttTTTTaatcacctcttgcttttgggtaaga
|bh006F|| forward extension oligo to construct j23099 || ggctaggatccATAAAActgtcttacccaaaagcaagagg
|bh006R|| reverse extension oligo to construct j23099 || ccatgaagcttTTTTatcacctcttgcttttgggtaagac
|bh007F|| forward extension oligo to construct j23122 || ggctaggatccATAAAAtctgtcttacccaaaagcaagag
|bh007R|| reverse extension oligo to construct j23122 || ccgataagcttTTTTtcacctcttgcttttgggtaagaca
|bh008F|| forward extension oligo to construct j23123 || ggctaggatccATAAAAttctgtcttacccaaaagcaaga
|bh008R|| reverse extension oligo to construct j23123 || ccgataagcttTTTTcacctcttgcttttgggtaagacag
|bh009F|| forward extension oligo to construct j230124 || ggctaggatccATAAAAtcttacccaaaagcaagaggtga
|bh009R|| reverse extension oligo to construct j23124 || ccgataagcttTTTTagaatcacctcttgcttttgggtaa
|bh010F|| forward extension oligo to construct j23125 || ggctaggatccATAAAActtacccaaaagcaagaggtgat
|bh010R|| reverse extension oligo to construct j23125 || ccgataagcttTTTTtagaatcacctcttgcttttgggta
|oligo|| name || sequence

Current revision

Return to main page

Name Description Sequence
2005iGEM1 RlamFwd caatcacgcgcaccccccggccgttttagcggctaaaaaagtcatgtgtaggctggagctgcttc
2005iGEM2 RlamRev acagcagggaagcagcgcttttccgctgcataaccctgcttcgggatgggaattagccatggtcc
2005iGEM10 TraJF-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatgtatccgatggatcgtattcaac
2005iGEM12 TraJR-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatggctgatgaaaccaagcc
2005iGEM18 FTJiamF ggtgacagtacgaaagataattagtatattaattacgtggttaat gtgtaggctggagctgcttc
2005iGEM19 FORlamF tttatccgtaaataatttaacccactccacaaaaaggctcaacag gtgtaggctggagctgcttc
2005iGEM20 FORlamR ggaccatggctaattcccat ctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaa
BBa_G00101 Reverse sequencing of pSB1A* plasmids attaccgcctttgagtgagc
ca850R Reverse EcoRI for FRT-Kan-Frt at P1 cacttGAATTCgtgtaggctggagctgcttc
ca997F EIPCR for Biobrick p15A/CmR plasmid ctcgaGGATCCTGCAGctagaaatattttatctgatt
ca998 Forward Sequencing of pSB1A2 gtatcacgaggcagaatttcag
ca999 Reverse sequencing of pSB1A2 (fails, don't use) ccgtattaccgcctttgagtg
ca1000 Forward sequencing of pSB3C6 (pAC997) cagggcagggtcgttaaatagc
ca1001 Reverse sequencing of pSB3C6 (pAC997) ggcggttttttcgttttcagagc
ca1002F Forward EcoRI oligo to make XbaI blunter cassette cttctggaattcgcggccgcaactagtgtccctatcag
ca1002R Reverse PstI oligo to make SpeI blunter cassette gaagcctgcagcggccgctTctagAatataaacgcag
ca1002F Forward EcoRI oligo to make XbaI blunter cassette cttctggaattcgcggccgcaactagtgtccctatcag
ca1002R Reverse PstI oligo to make SpeI blunter cassette gaagcctgcagcggccgctTctagAatataaacgcag
ca1010F Forward (universal biobrick) EcoRI for FRT GGACTgaattcgcggccgcttctagag
ca1010R Reverse SpeI oligo for FRT cctatactagtagaagttcctattctctaAaaagtataggaacttcctctagaagcggccgcg
ca1016F Forward EcoRI to biobrick CAT of pKD3 gacttgaattcgcggccgcttctagaggaataggaacttcatttaaatg
ca1016R Reverse SpeI to biobrick CAT of pKD3 ccgctactagtggcgcgcctacctgtgacgg
ca1020F Forward SpeI oligo for X-rbsRFP-P plasmid gcactACTAGTgaaagaggagaaatactagatggc
ca1020R Reverse PstI oligo for X-rbsRFP-P plasmid ccggactgcagcggccgcttctagtatataaacg
ca1025F Forward quickchange for GFP[S56AGGA] gaaacagcatgactttttcaagAGGAgccatgcccgaaggttatgtac
ca1025R Reverse quickchange for GFP[S56AGGA] gtacataaccttcgggcatggcTCCTcttgaaaaagtcatgctgtttc
ca1027R Reverse SpeI to fix lock3 variant rbs spacing gaagccaactagtatttctcctctt
ca1028F Forward XbaI to extend lock3 variants gcatgTCTAGAGtgtagaccgAACTAGAATCACCTCTTGC
ca1029R Reverse oligo for Pcon gacttActagtaGCTAGCattataCCTAGGactgaGCTAGCtgtcaactctagAAGCGGCCGCGAA KB001 Forward EcoRI to construct Ptet part-making biobrick plasmid ttctggaattcgcggccgcaactagagccaggcatc
KB002 Reverse XbaI to construct Ptet part-making biobrick plasmid ccgctTctagAagtgctcagtatc
KB003 Forward XbaI oligo for part3b ctccatctagagACCCAAAAGCAAGAGGTGATTCTAGTTtac
KB004 Reverse PstI oligo for part3b gcgaactgcagcggccgctactagtaAACTAGAATCACCTCTTG
KB005 Forward XbaI oligo for part 3c ccatatctagagACCCAAAAGCAAGAGGTGATTCTAGTTggtggttaatgaaaattaacttacttactagaaat
KB006 Reverse PstI oligo for part 3c catctctgcagcggccgctactagtaaagccggattaataatctggctttttagagatatttctagtaagtaagttaa
KB007 Forward XbaI oligo for part 3d TctagAgcgggcgggcgggcgggcgggatccataaaaaaaaaACCCAAAAGCAAGAGGTGATTCTAGTTaaa
KB008 Reverse PstI oligo for part 3d ctgcaggcggccgctactagtacgggcgggcgggcgggcgggaagctttttttttttAACTAGAATCACCTCTT
KB009 Forward Ptet screening oligo tccctatcagtgatagagat
KB010 Forward Lock2 screening oligo aactagaatcacctctagtg
KB011 Forward mRFP1 screening oligo atggcttcctccgaagacgt
KB012 KB009 5' add on CACTGTctagAgcgggcgggcgggc
KB013 KB010 3' add on CCAAActgcaggcggccgctactag
KB014 Lock3 4 base add-on to 3' end of hairpin loop forward oligo GTCGATCTAGAGAACTAGAATCACCTCTTGCTTTTGGGTAAGAC
KB015 Lock3 1 base add-on to 3' end of hairpin loop reverse oligo CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTGTCTTACCCAAAAGCAAGAG
KB016 Lock3 2 base add-on to 3' end of hairpin loop reverse oligo CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTCGTCTTACCCAAAAGCAAGAG
KB017 Lock3 4 base add-on to 3' end of hairpin loop reverse oligo CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTCTGTCTTACCCAAAAGCAAGAG
KB018 Lock3 one point mutation on the 5' end of the 3' homology region forward oligo GTCGATCTAGAGAACTAGAATCAACTCTTGCTTTTGGGTAAGAAAGAGG
KB019 Lock3 one point mutation on the 5' end of the 3' homology region reverse oligo CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTTCTTACCCAAAAGC
KB020 Lock3 two consecutive point mutations on the 5' end of the 3' homology region forward oligo GTCGATCTAGAGAACTAGAATCAATTCTTGCTTTTGGGTAAGAAAGAGG
KB021 Lock3 one point mutation on the 3' end of the 3' homology region forward oligo GTCGATCTAGAGAACTAGAATCACCTCTAGCTTTTGGGTAAGAAAGAGG
KB022 Lock3 two consecutive point mutations on the 3' end of the 3' homology region forward oligo GTCGATCTAGAGAACTAGAATCACCTCAAGCTTTTGGGTAAGAAAGAGG
JL1 Forward EcoRI to make spectinomycin resistance biobrick gacttgaattcgcggccgcttctagagtccaagcgagctcgatatc
JL2 Reverse SpeI to make spectinomycin resistance biobrick ccgctactagtCAGCAACGATGTTACGCAGC
JL3 forward oligo to characterize oriTF/TraM region gatggcattaacccggtaac
JL4 reverse oligo to characterize oriTF/TraM region+50bp ctaattatctttcgtactgtc
JL5 Forward EcoRI oligo to bioBrick TraM CCTAGGAATTCGCGGCCGCTTCTAGatggctaaggtgaacctgtatatcagc
JL6 Reverse SpeI oligo to bioBrick TraM gacttACTAGTgtcaaatttcgtttattcatc
JL7 Reverse knockout oligo for oriT/traM cataaaaactctgatatttgaacgaagtcaaatttcgtttATGGGAATTAGCCATGGTCC
JL8 Forward oligo to knockout traG-R atgaagaaccgaaacaacgccgtggggccacagatacgggcgaaagtgCaggctggagctgcttcgaag
JL9 Reverse oligo to knockout traG-R tcatatcgtgatcccctccccttcctcgacggtggccgtctggattgggaaGtagccatggtccatatg
JL10 Forward EcoRI oligo to bioBrick TraG *Internal NotI site CCTAGGAATTCGCGGCCGCTTCTAGatgaagaaccgaaacaacgc
JL11 Reverse SpeI oligo to bioBrick TraG *internal NotI site gacttACTAGTgaagcggctcatatcgtgatc
JL12 Forward oligo to knockout trbC


JL13 Reverse oligo to knockout trbC tcatttcccggaatctcctttccctgccagtaaatcatgagccactgggaaGtagccatggtccatatg
JL14 Forward EcoRI oligo to bioBrick trbC *internal PstI site CCTAGGAATTCGCGGCCGCTTCTAGatgaagctgagtatgaaatc
JL15 Reverse SpeI oligo to bioBrick trbC *internal PstI site gacttACTAGTcgtttcatttcccggaatctc
JL16 Forward trbC 20mers gctggcgttaccagatggtg
JL17 Reverse trbC 20mers gccctgaatactgctgcttcc
JL18 Forward TraG 20mers ctgattatgttggtgcgctg
Jl19 Reverse TraG 20mers cattcgatttccagtacaggc
JL20 Forward BglII to BamHI for traG-5' knockout cassette GAGTCAGATCTgattatgttggtgcgctg
JL21 Reverse MfeI to EcoRI for traG-5' knockout cassette gctggCAATTGcattcgatttccagtacaggc
JL22 Reverse EcoRI IPCR of traG gctgcGAATTCgatactggaaggaatgggc
JL23 Forward PstI IPCR of traG cattgCTGCAGacggcagcattgaagaggcg
bh001 forward XbaI oligo for RBS modification of J01022 gatcgTCTAGAaaagaggagatactagATGgcttcctccgaa
bh002F forward extension oligo to construct J23082 gatcgggatccATAAAAaagaggtgattctagttcggtct
bh002R reverse extension oligo to construct J23082 ctagcaagcttTTTTgtgtagaccgaactagaatcacctc
bh003F forward extension oligo to construct J23083 gatcgggatccATAAAAaaagcaagaggtgattctagttc
bh003R reverse extension oligo to construct J23083 catcgaagcttTTTTgaccgaactagaatcacctcttgct
bh004F forward extension oligo to construct J23084 gatcgggatccATAAAAgtcttacccaaaagcaagaggtg
bh004R reverse extension oligo to construct J23084 cagctaagcttTTTTgaatcacctcttgcttttgggtaag
SIL01 Forward BamH oligo to construct J23201 GTCATggatccataaaacccaaaagcaagaggtgattc
SIL02 Reverse HindIII oligo to construct J23201 GATACaagctttttaactagaatcacctcttgcttttg
SIL03 Forward BamH oligo to construct J23202 GTCATggatccataaaaaacccaaaagcaagaggtgattc
SIL04 Reverse HindIII oligo to construct J23202 GATACaagctttttttaactagaatcacctcttgcttttg
SIL05 Forward BamH oligo to construct J23203 GTCATggatccataaaaaaaacccaaaagcaagaggtgattc
SIL06 Reverse HindIII oligo to construct J23203 GATACaagctttttttttaactagaatcacctcttgcttttg
SIL07 Forward BamH oligo to construct J23204 GTCATggatccataaaaaaaaaaaacccaaaagcaagaggtgattc
SIL08 Reverse HindIII oligo to construct J23204 GATACaagctttttttttttttaactagaatcacctcttgcttttg
SIL09 Forward BamH oligo to construct J23205 GTCATggatccataaaaaaaaaaaaaacccaaaagcaagaggtgattc
SIL10 Reverse HindIII oligo to construct J23205 GATACaagctttttttttttttttaactagaatcacctcttgcttttg
SIL11 Forward BamH oligo to construct J23206 GTCATggatccataaaaaaaaaaaaaaaacccaaaagcaagaggtgattc
SIL12 Reverse HindIII oligo to construct J23206 GATACaagctttttttttttttttttaactagaatcacctcttgcttttg
SIL13 Forward BamH oligo to construct J23207 GTCATggatccataaaaaaaaaaaaaaaaaacccaaaagcaagaggtgattc
SIL14 Reverse HindIII oligo to construct J23207 GATACaagctttttttttttttttttttaactagaatcacctcttgcttttg
SIL15 Forward BamH oligo to construct J23208 GTCATggatccataaaaaaaaaaaaaaaaaaaacccaaaagcaagaggtgattc
SIL16 Reverse HindIII oligo to construct J23208 GATACaagctttttttttttttttttttttaactagaatcacctcttgcttttg
bh005F forward extension oligo to construct j23098 ggctaggatccATAAAAtgtcttacccaaaagcaagaggt
bh005R reverse extension oligo to construct j23098 ccgataagcttTTTTaatcacctcttgcttttgggtaaga
bh006F forward extension oligo to construct j23099 ggctaggatccATAAAActgtcttacccaaaagcaagagg
bh006R reverse extension oligo to construct j23099 ccatgaagcttTTTTatcacctcttgcttttgggtaagac
bh007F forward extension oligo to construct j23122 ggctaggatccATAAAAtctgtcttacccaaaagcaagag
bh007R reverse extension oligo to construct j23122 ccgataagcttTTTTtcacctcttgcttttgggtaagaca
bh008F forward extension oligo to construct j23123 ggctaggatccATAAAAttctgtcttacccaaaagcaaga
bh008R reverse extension oligo to construct j23123 ccgataagcttTTTTcacctcttgcttttgggtaagacag
bh009F forward extension oligo to construct j230124 ggctaggatccATAAAAtcttacccaaaagcaagaggtga
bh009R reverse extension oligo to construct j23124 ccgataagcttTTTTagaatcacctcttgcttttgggtaa
bh010F forward extension oligo to construct j23125 ggctaggatccATAAAActtacccaaaagcaagaggtgat
bh010R reverse extension oligo to construct j23125 ccgataagcttTTTTtagaatcacctcttgcttttgggta
oligo name sequence
Personal tools