
From OpenWetWare

Revision as of 16:26, 7 June 2006 by JCAnderson (Talk | contribs)
Jump to: navigation, search

Name Description Sequence Sites
ca997F EIPCR for Biobrick p15A/CmR plasmid ctcgaGGATCCTGCAGctagaaatattttatctgatt BamHI,PstI
ca998 Forward Sequencing of pSB1A2 gtatcacgaggcagaatttcag
ca999 Reverse sequencing of pSB1A2 ccgtattaccgcctttgagtg
Personal tools