
From OpenWetWare

Revision as of 19:35, 9 June 2006 by Bosworth (Talk | contribs)
Jump to: navigation, search

Return to main page

Name Description Sequence Sites
ca997F EIPCR for Biobrick p15A/CmR plasmid ctcgaGGATCCTGCAGctagaaatattttatctgatt BamHI,PstI
ca998 Forward Sequencing of pSB1A2 gtatcacgaggcagaatttcag
ca999 Reverse sequencing of pSB1A2 ccgtattaccgcctttgagtg
2005iGEM1 RlamFwd caatcacgcgcaccccccggccgttttagcggctaaaaaagtcatgtgtaggctggagctgcttc
2005iGEM2 RlamRev acagcagggaagcagcgcttttccgctgcataaccctgcttcgggatgggaattagccatggtcc
2005iGEM5 TraJF-BBRev CACGAACTGCAGCGGCCGCTACTAGTAttaacgcgtatttatgatacacatagc
2005iGEM10 TraJF-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatgtatccgatggatcgtattcaac
2005iGEM12 TraJR-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatggctgatgaaaccaagcc
2005iGEM18 FTJiamF ggtgacagtacgaaagataattagtatattaattacgtggttaat gtgtaggctggagctgcttc
2005iGEM19 FORlamF tttatccgtaaataatttaacccactccacaaaaaggctcaacag gtgtaggctggagctgcttc
2005iGEM20 FORlamR ggaccatggctaattcccat ctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaa
Personal tools