
From OpenWetWare

Revision as of 15:32, 18 July 2006 by Pineapplequeen (Talk | contribs)
Jump to: navigation, search

Return to main page

Name Description Sequence Sites
ca997F EIPCR for Biobrick p15A/CmR plasmid ctcgaGGATCCTGCAGctagaaatattttatctgatt BamHI,PstI
ca998 Forward Sequencing of pSB1A2 gtatcacgaggcagaatttcag
ca999 Reverse sequencing of pSB1A2 (fails, don't use) ccgtattaccgcctttgagtg
2005iGEM1 RlamFwd caatcacgcgcaccccccggccgttttagcggctaaaaaagtcatgtgtaggctggagctgcttc
2005iGEM2 RlamRev acagcagggaagcagcgcttttccgctgcataaccctgcttcgggatgggaattagccatggtcc
2005iGEM5 TraJF-BBRev CACGAACTGCAGCGGCCGCTACTAGTAttaacgcgtatttatgatacacatagc
2005iGEM10 TraJF-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatgtatccgatggatcgtattcaac
2005iGEM12 TraJR-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatggctgatgaaaccaagcc
2005iGEM18 FTJiamF ggtgacagtacgaaagataattagtatattaattacgtggttaat gtgtaggctggagctgcttc
2005iGEM19 FORlamF tttatccgtaaataatttaacccactccacaaaaaggctcaacag gtgtaggctggagctgcttc
2005iGEM20 FORlamR ggaccatggctaattcccat ctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaa
ca1000 Forward sequencing of pSB3C6 (pAC997) cagggcagggtcgttaaatagc
ca1001 Reverse sequencing of pSB3C6 (pAC997) ggcggttttttcgttttcagagc
BBa_G00101 Reverse sequencing of pSB1A* plasmids attaccgcctttgagtgagc
ca1002F Forward EcoRI oligo to make XbaI blunter cassette cttctggaattcgcggccgcaactagtgtccctatcag
ca1002R Reverse PstI oligo to make SpeI blunter cassette gaagcctgcagcggccgctTctagAatataaacgcag
KB001 Forward EcoRI to construct Ptet part-making biobrick plasmid ttctggaattcgcggccgcaactagagccaggcatc
KB002 Reverse XbaI to construct Ptet part-making biobrick plasmid ccgctTctagAagtgctcagtatc
KB003 Forward XbaI oligo for part3b ctccatctagagACCCAAAAGCAAGAGGTGATTCTAGTTtac
KB004 Reverse PstI oligo for part3b gcgaactgcagcggccgctactagtaAACTAGAATCACCTCTTG
KB005 Forward XbaI oligo for part 3c ccatatctagagACCCAAAAGCAAGAGGTGATTCTAGTTggtggttaatgaaaattaacttacttactagaaat
KB006 Reverse PstI oligo for part 3c catctctgcagcggccgctactagtaaagccggattaataatctggctttttagagatatttctagtaagtaagttaa
KB007 Forward XbaI oligo for part 3d TctagAgcgggcgggcgggcgggcgggatccataaaaaaaaaACCCAAAAGCAAGAGGTGATTCTAGTTaaa
KB008 Reverse PstI oligo for part 3d ctgcaggcggccgctactagtacgggcgggcgggcgggcgggaagctttttttttttAACTAGAATCACCTCTT
JL1 Forward EcoRI to make spectinomycin resistance biobrick gacttgaattcgcggccgcttctagagtccaagcgagctcgatatc
JL2 Reverse SpeI to make spectinomycin resistance biobrick ccgctactagtCAGCAACGATGTTACGCAGC
JL3 forward oligo to characterize oriTF/TraM region gatggcattaacccggtaac
JL4 reverse oligo to characterize oriTF/TraM region+50bp ctaattatctttcgtactgtc
JL5 Forward EcoRI oligo to bioBrick TraM CCTAGGAATTCGCGGCCGCTTCTAGatggctaaggtgaacctgtatatcagc
JL6 Reverse SpeI oligo to bioBrick TraM gacttACTAGTgtcaaatttcgtttattcatc
JL7 Reverse knockout oligo for oriT/traM cataaaaactctgatatttgaacgaagtcaaatttcgtttATGGGAATTAGCCATGGTCC
JL8 Forward oligo to knockout traG-R atgaagaaccgaaacaacgccgtggggccacagatacgggcgaaagtgCaggctggagctgcttcgaag
JL9 Reverse oligo to knockout traG-R tcatatcgtgatcccctccccttcctcgacggtggccgtctggattgggaaGtagccatggtccatatg
JL10 Forward EcoRI oligo to bioBrick TraG *Internal NotI site CCTAGGAATTCGCGGCCGCTTCTAGatgaagaaccgaaacaacgc
JL11 Reverse SpeI oligo to bioBrick TraG *internal NotI site gacttACTAGTgaagcggctcatatcgtgatc
JL12 Forward oligo to knockout trbC


JL13 Reverse oligo to knockout trbC tcatttcccggaatctcctttccctgccagtaaatcatgagccactgggaaGtagccatggtccatatg
JL14 Forward EcoRI oligo to bioBrick trbC *internal PstI site CCTAGGAATTCGCGGCCGCTTCTAGatgaagctgagtatgaaatc
JL15 Reverse SpeI oligo to bioBrick trbC *internal PstI site gacttACTAGTcgtttcatttcccggaatctc
KB009 Forward Ptet screening oligo tccctatcagtgatagagat
Personal tools