Berk2006-Oligos

From OpenWetWare

Revision as of 23:25, 31 July 2006 by JCAnderson (Talk | contribs)
Jump to: navigation, search

Return to main page


Name Description Sequence Sites
ca997F EIPCR for Biobrick p15A/CmR plasmid ctcgaGGATCCTGCAGctagaaatattttatctgatt BamHI,PstI
ca998 Forward Sequencing of pSB1A2 gtatcacgaggcagaatttcag
ca999 Reverse sequencing of pSB1A2 (fails, don't use) ccgtattaccgcctttgagtg
2005iGEM1 RlamFwd caatcacgcgcaccccccggccgttttagcggctaaaaaagtcatgtgtaggctggagctgcttc
2005iGEM2 RlamRev acagcagggaagcagcgcttttccgctgcataaccctgcttcgggatgggaattagccatggtcc
2005iGEM3 TraJ-F-Rev TTAACGCGTATTTATGATACACATAGC
2005iGEM4 TraJ-F-For ATGTATCCGATGGATCGTATTCAAC
2005iGEM5 TraJF-BBRev CACGAACTGCAGCGGCCGCTACTAGTAttaacgcgtatttatgatacacatagc
2005iGEM6 FCtra-rev CCATAGATATTCCCTGCCCTG
2005iGEM7 FCtra-fwd CTCAGTCCTCATGTCTCCGG
2005iGEM8 OriTBackwardBB CATTAGAGATTACCTTTTTTGAAC
2005iGEM9 oriTforwardF AAGGCTCAACAGGTTGGTGGTTC
2005iGEM10 TraJF-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatgtatccgatggatcgtattcaac
2005iGEM11 TraJR-BBRev CACGAACTGCAGCGGCCGCTACTAGTAtcatggctctgccctcg
2005iGEM12 TraJR-BBFor gcagcaGAATTCGCGGCCGCTTCTAGAGatggctgatgaaaccaagcc
2005iGEM13 FTJiamR CAGAAAAGACGGAAAGTCTATATTTTATTAACACCTTATTAACGCG ATGGGAATTAGCCATGGTCC
2005iGEM14 OriT-R-Rev TTTTCCGCTGCATAACCCTGC
2005iGEM15 TraJ-R-For ATGGCTGATGAAAGCAAGCC
2005iGEM16 TraJ-R-Rev TCATGGCTCTGCCTCG
2005iGEM17 OriT-R-For GCCGCCTTTTCCTCAATCG
2005iGEM18 FTJiamF ggtgacagtacgaaagataattagtatattaattacgtggttaat gtgtaggctggagctgcttc
2005iGEM19 FORlamF tttatccgtaaataatttaacccactccacaaaaaggctcaacag gtgtaggctggagctgcttc
2005iGEM20 FORlamR ggaccatggctaattcccat ctctttatgatatttaaaaaagcggtgtcggcgcggctacaacaa
2005iGEM21 tabbR CTGCAGCGGCCGCTACTAGTAATTATAG...
2005iGEM22 tabb1R CTGCAGCGGCCGCTACTAGTATCTGCAG...
2005iGEM23 tabb2R CTGCAGCGGCCGCTACTAGTAATAACGT...
2005iGEM24 crbb1R CTGCAGCGGCCGCTACTAGTATCTCCTC...
2005iGEM25 crbb2R CTGCAGCGGCCGCTACTAGTATCTCCTC...
2005iGEM26 tabb2F GAATTCGCGGCCGCTTCTAGAGACCCAA...
2005iGEM27 crR12wBBR AGCAGCCTGCAGCGGCCGCTACTAGTAG...
2005iGEM28 rrnBP1F GCAGCAGAATTCGCGGCCGCTTCTAGAG...
2005iGEM29 crbb2F GAATTCCGGCCGCTTCTAGAGAACTAG...
2005iGEM30 rrnBP1R AGCAGCCTGCAGCGGCCGCTACTAGTAG...
2005iGEM31 crR12wBBF GCAGCAGAATTCGCGGCCGCTTCTAGAG...
2005iGEM32 Vlad-fwd ATACTCGAGATGGCGAGCAGTGAGGACA...
2005iGEM33 vlad-rev ATAGAATTCTACAGGAAGAGGTGGTGG
2005iGEM34 crbb1F GAATTCGCGGCCGCTTCTAGAGAACTAG...
2005iGEM35 tabbF GAATTCGCGGCCGCTTCTAGAGAGAAAA...
2005iGEM36 tabbF GAATTCGCGGCCGCTTCTAGAGACCCAA...
2005iGEM37 ChrrF GCAGCAGAATTCGCGGCCGCTTCTAGAGATGACGATCCGGCACCATGT
2005iGEM38 ChrR Reverse CACGAACTGCAGCGGCCGCTACTAGTATCAGATGCGGAAGAAGGGCT
2005iGEM39 Predreverse TCGACTTCTGCAGCGGCCGCTACTAGTA...
2005iGEM40 RpoEreverse TCGACTTCTGCAGCGGCCGCTACTAGTATCAACTCATATGCTGGCGCAGACG
2005iGEM41 gfp_r GCGGCGAAGCTTTTCCATGCC
2005iGEM42 gfp_f1 GCGGCGGGTACCCAGAACT
2005iGEM43 RpoEforward CCTAGGAATTCGCGGCCGCTTCTAGAGGTGACGGACAAGAGTGACAGGAC
2005iGEM44 RpoEp1reverse TCGACTTCTGCAGCGGCCGCTACTAGTACCGCCCGGAGGTGAAGATAG
2005iGEM45 RpoEp1forward CCTAGGAATTCGCGGCCGCTTCTAGAGTTTTTCCCGCCTCCCGCCTG
2005iGEM46 spoIIEreverse TCGACTTCTGCAGCGGCCGCTACTAGTATCCTCTCATCTCCCACCTGTTATAT
2005iGEM47 SpoIIEforward CCTAGGAATTCGCGGCCGCTTCTAGAGCGGGTCATCCTAACAAATCGGTTTC
2005iGEM48 BPredForrward CCTAGGAATTCGCGGCCGCTTCTAGAGATGGCGAGCAGTGAGGACATCATC
ca1000 Forward sequencing of pSB3C6 (pAC997) cagggcagggtcgttaaatagc
ca1001 Reverse sequencing of pSB3C6 (pAC997) ggcggttttttcgttttcagagc
BBa_G00101 Reverse sequencing of pSB1A* plasmids attaccgcctttgagtgagc
ca1002F Forward EcoRI oligo to make XbaI blunter cassette cttctggaattcgcggccgcaactagtgtccctatcag
ca1002R Reverse PstI oligo to make SpeI blunter cassette gaagcctgcagcggccgctTctagAatataaacgcag
ca994F forward Xba1 library for Key3 CCTATtctagaGACCCAAAAGCANGAGGNNNNNNTAGTNGGTGGTTAATGAAAATTAACTTACTTACTAG
KB001 Forward EcoRI to construct Ptet part-making biobrick plasmid ttctggaattcgcggccgcaactagagccaggcatc
KB002 Reverse XbaI to construct Ptet part-making biobrick plasmid ccgctTctagAagtgctcagtatc
KB003 Forward XbaI oligo for part3b ctccatctagagACCCAAAAGCAAGAGGTGATTCTAGTTtac
KB004 Reverse PstI oligo for part3b gcgaactgcagcggccgctactagtaAACTAGAATCACCTCTTG
KB005 Forward XbaI oligo for part 3c ccatatctagagACCCAAAAGCAAGAGGTGATTCTAGTTggtggttaatgaaaattaacttacttactagaaat
KB006 Reverse PstI oligo for part 3c catctctgcagcggccgctactagtaaagccggattaataatctggctttttagagatatttctagtaagtaagttaa
KB007 Forward XbaI oligo for part 3d TctagAgcgggcgggcgggcgggcgggatccataaaaaaaaaACCCAAAAGCAAGAGGTGATTCTAGTTaaa
KB008 Reverse PstI oligo for part 3d ctgcaggcggccgctactagtacgggcgggcgggcgggcgggaagctttttttttttAACTAGAATCACCTCTT
JL1 Forward EcoRI to make spectinomycin resistance biobrick gacttgaattcgcggccgcttctagagtccaagcgagctcgatatc
JL2 Reverse SpeI to make spectinomycin resistance biobrick ccgctactagtCAGCAACGATGTTACGCAGC
JL3 forward oligo to characterize oriTF/TraM region gatggcattaacccggtaac
JL4 reverse oligo to characterize oriTF/TraM region+50bp ctaattatctttcgtactgtc
JL5 Forward EcoRI oligo to bioBrick TraM CCTAGGAATTCGCGGCCGCTTCTAGatggctaaggtgaacctgtatatcagc
JL6 Reverse SpeI oligo to bioBrick TraM gacttACTAGTgtcaaatttcgtttattcatc
JL7 Reverse knockout oligo for oriT/traM cataaaaactctgatatttgaacgaagtcaaatttcgtttATGGGAATTAGCCATGGTCC
JL8 Forward oligo to knockout traG-R atgaagaaccgaaacaacgccgtggggccacagatacgggcgaaagtgCaggctggagctgcttcgaag
JL9 Reverse oligo to knockout traG-R tcatatcgtgatcccctccccttcctcgacggtggccgtctggattgggaaGtagccatggtccatatg
JL10 Forward EcoRI oligo to bioBrick TraG *Internal NotI site CCTAGGAATTCGCGGCCGCTTCTAGatgaagaaccgaaacaacgc
JL11 Reverse SpeI oligo to bioBrick TraG *internal NotI site gacttACTAGTgaagcggctcatatcgtgatc
JL12 Forward oligo to knockout trbC

atgaagctgagtatgaaatctctggcagcactgctgatgatgctggtgCaggctggagctgcttcgaag

JL13 Reverse oligo to knockout trbC tcatttcccggaatctcctttccctgccagtaaatcatgagccactgggaaGtagccatggtccatatg
JL14 Forward EcoRI oligo to bioBrick trbC *internal PstI site CCTAGGAATTCGCGGCCGCTTCTAGatgaagctgagtatgaaatc
JL15 Reverse SpeI oligo to bioBrick trbC *internal PstI site gacttACTAGTcgtttcatttcccggaatctc
KB009 Forward Ptet screening oligo tccctatcagtgatagagat
KB010 Forward Lock2 screening oligo aactagaatcacctctagtg
KB011 Forward mRFP1 screening oligo atggcttcctccgaagacgt
KB012 KB009 5' add on CACTGTctagAgcgggcgggcgggc
KB013 KB010 3' add on CCAAActgcaggcggccgctactag
JL16 Forward trbC 20mers gctggcgttaccagatggtg
JL17 Reverse trbC 20mers gccctgaatactgctgcttcc
KB014 Lock3 4 base add-on to 3' end of hairpin loop forward oligo GTCGATCTAGAGAACTAGAATCACCTCTTGCTTTTGGGTAAGAC
KB015 Lock3 1 base add-on to 3' end of hairpin loop reverse oligo CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTGTCTTACCCAAAAGCAAGAG
KB016 Lock3 2 base add-on to 3' end of hairpin loop reverse oligo CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTCGTCTTACCCAAAAGCAAGAG
KB017 Lock3 4 base add-on to 3' end of hairpin loop reverse oligo CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTCTGTCTTACCCAAAAGCAAGAG
KB018 Lock3 one point mutation on the 5' end of the 3' homology region forward oligo GTCGATCTAGAGAACTAGAATCAACTCTTGCTTTTGGGTAAGAAAGAGG
KB019 Lock3 one point mutation on the 5' end of the 3' homology region reverse oligo CCGATCTGCAGCGGCCGCTACTAGTATCTCCTCTTTCTTACCCAAAAGC
KB020 Lock3 two consecutive point mutations on the 5' end of the 3' homology region forward oligo GTCGATCTAGAGAACTAGAATCAATTCTTGCTTTTGGGTAAGAAAGAGG
KB021 Lock3 one point mutation on the 3' end of the 3' homology region forward oligo GTCGATCTAGAGAACTAGAATCACCTCTAGCTTTTGGGTAAGAAAGAGG
KB022 Lock3 two consecutive point mutations on the 3' end of the 3' homology region forward oligo GTCGATCTAGAGAACTAGAATCACCTCAAGCTTTTGGGTAAGAAAGAGG


Personal tools