Berk2010-Amy
From OpenWetWare
| Line 13: | Line 13: | ||
*transform jtk159 with 2017 | *transform jtk159 with 2017 | ||
*Submit 2345 in pmll vector for seq off tetR too | *Submit 2345 in pmll vector for seq off tetR too | ||
| + | |||
| + | ==[[User:Amy N. Kristofferson|Amy N. Kristofferson]] 17:29, 30 September 2010 (EDT)== | ||
| + | Yesterday, I grew up 4mL of each of the payloads. Today I transfered 200uL of saturated solution to 20mL of LB-amp media. | ||
==[[User:Amy N. Kristofferson|Amy N. Kristofferson]] 19:15, 24 September 2010 (EDT)== | ==[[User:Amy N. Kristofferson|Amy N. Kristofferson]] 19:15, 24 September 2010 (EDT)== | ||
Revision as of 17:29, 30 September 2010
Long term:
- Co-transform 51 and 52 in CK w/ all payloads
- Use functional ptet-self lysis for transposase assay
- Finish Jin's assembly
To do for SL/VB assembly...
- ask Jin about 2017
- transform jtk159 with 2017
- Submit 2345 in pmll vector for seq off tetR too
Amy N. Kristofferson 17:29, 30 September 2010 (EDT)
Yesterday, I grew up 4mL of each of the payloads. Today I transfered 200uL of saturated solution to 20mL of LB-amp media.
Amy N. Kristofferson 19:15, 24 September 2010 (EDT)
- Submit newly assembled parts for sequencing.
- Pick colonies. Colpcr 2093 colonies. No need to check for co-transf.
Amy N. Kristofferson 17:20, 23 September 2010 (EDT)
- Ligate Eco/bam 51/52 into CK/KC again
- Ligate 2093 (conor gel purified it) with pmllAC vector
Ligation started at 3:55pm. Rescue started at 4:50pm.
- Map/sequence assembly minipreps
| Lane | Part | Digest | Expected Length | Good? |
| 1 | 164a | Eco/Bam | 717, 2671 | yes |
| 2 | 164b | Eco/Bam | yes | |
| 3 | 165a1 | Eco/Bam | 710, 2671 | yes |
| 4 | 165a2 | Eco/Bam | no (169a?) | |
| 5 | 165b | Eco/Bam | yes | |
| 6 | 166a | Eco/Bam | 511, 2671 | yes |
| 7 | 166b | Eco/Bam | yes | |
| 8 | 167a | Eco/Bam | 3489, 2745 | ok |
| 9 | 167b | Eco/Bam | yes | |
| 10 | 168a | Eco/XhoI | 3703, 1672 | no |
| 11 | 168b | Eco/XhoI | yes | |
| 12 | 169b | Eco/XhoI | 3944, 1672 | yes |
| 13 | 2142 in pmllAC a | Eco/Bam | 1495, 2745 | ok |
| 14 | 2142 in pmllAC b | Eco/Bam | ok |
Digest started at 4:32pm.
- Run colPCR from sbb42 assem
- Miniprep sbb42 assembly
- Submit newly assembled 45b, 46a, 47a with 63 and g00101 oligos. Transform in jtk159 so we can do a self-lysis test.
Amy N. Kristofferson 19:23, 22 September 2010 (EDT)
- Miniprepped assemblies and 2143
- Gel purified 51/52
- Picked colonies, checked for co-transf. and ran colPCR of sbb42 assembly
Amy N. Kristofferson 18:11, 21 September 2010 (EDT)
To in this order: Conor's Zymo 4:23
- Miniprep 2093, 51, 52
- Eco/Bam map 51, 52. Eco/Bam digest 2093. Gel purify. Digest started at 4:25pm.
| ' | ' |
| Lane | Part |
| 1 | 51a |
| 2 | 51b |
| 3 | 52c |
| 4 | 52a? |
| 5 | 52a? |
| 6 | 52d |
Everything looks wrong. Tahoura's going to pick colonies and test for lysis tomorrow.
- start sbb42 assembly. Lig started at 4:36pm. Transformed jtk159. Conor plated.
- Pick colonies from assembly. ColPCR, co-transf. test
Amy N. Kristofferson 17:53, 20 September 2010 (EDT)
- Map 51/52 Eco/Bam
- Pick colonies 2093
- Righty digest sbb42 in pMLL-AK
Ligations
Assembly of iGEM10_164-9 and ligation of jh2142 to pmllAC started at 3:25pm.
Transformed jtk159. Rescue started at 4:09pm. Plate 164-6 on CK and 166-9, 2142 on CA.
Analytical Digests
51 and 52 eco/bam'd into CK:
Lane 1-3: 51, Lane 4-6: 52. Expected lengths 51: 5763, 52: 6332 and 2617 (backbone)
Tomorrow: co-transform good ones with all payloads.
Assembly digests
Bgl/XhoI'd 2uL of sbb42.
Amy N. Kristofferson 01:18, 20 September 2010 (EDT)
Miniprepped 51 and 52 Eco/Bam transfers
Stored in Temp Miniprep box. Need to be mapped. ColPCR showed nothing.
Digests
Started at 10:11pm.
| Lane | Part | Digest |
| 1 | Bjh2271 in CA a | Lefty |
| 2 | Bjh2642 in CA c | Lefty |
| 3 | iGEM10_001 in CK | Lefty |
| 4 | iGEM10_005 in KA a | Righty |
| 5 | iGEM10_010 in KA b | Righty |
| 6 | iGEM10_017 in KA a | Righty |
| 7 | sbb06, Romeo H3 in AK | Righty |
| 8 | sbb12, Romeo F4 in AK | Righty |
| 9 | sbb09, Romeo G3 in AK | Righty |
| 10 | Bjh2142 in 1601CK | Eco/Bam |
Transformations
jh2093 in 1601AC into jtk049 to get rid of righty methylation.
Started rescue at 10:44.
Amy N. Kristofferson 16:26, 17 September 2010 (EDT)
- Ligated Eco/Bam digest 51/52 with pmllCK at 1:27pm
- Transformed jtk030 cells
- ColPCR of Eco/Bam:
| Lanes | Part | Expected length for colPCR | Good | Miniprep |
| 1--4 | sbb09 PCR product | 235 | d | c,d |
| 5--8 | Bjh2271 | 1214 | a-d | a,b |
| 9--12 | jtk2642 | 676 | a,c,d | c,d |
| 13--16 | iGEM10_005 | 2354 | a,b | |
| 17--20 | iGEM10_010 | 1505 | b,c,d | b,d |
| 21--24 | iGEM10_017 | 1746 | a-d | a,b |
Amy N. Kristofferson 19:10, 16 September 2010 (EDT)
Started Eco/Bam Mapping of 45-48 at 4:00pm. Run analytical gel at 4:30pm. Expected lengths for 45,46,47,48: 5548, 6117, 5533, 6102bp.
45a-d, 46a-d, 47a-d, 48a-d
Started Eco/Bam digest of 51, 52, sbb06 and sbb12 at 4:05pm. Cut out 5763, 6332 for 51,52 and 241, 234 for sbb06 and sbb12. Make sure not to run the gel too long!! And do a small frag clean-up?
sbb06 and 12 ran out again :(
51 and 51 digests are in my perfect parts box.
Amy N. Kristofferson 23:57, 15 September 2010 (EDT)
Ligated and transformed the following:
| Eco/Bam digest | Ligate with | Transform into |
| Bjh2271 | pMLL-CA | jtk049 |
| iGEM10_005 | pMLL-KA | jtk030 |
| iGEM10_010 | pMLL-KA | jtk030 |
| iGEM10_017 | pMLL-KA | jtk030 |
| sbb09 PCR product | pMLL-CK | jtk030 |
Started rescue at 8:55pm.
Amy N. Kristofferson 19:47, 14 September 2010 (EDT)
Turns out I don't need to transfer sbb42 into a new vector, since it's already in AK. Also, I won't need transfered sbb09 (3' TR for Tn5) until step two of assembly, so I'll go ahead and Eco/Bam transfer all the other parts I need until I can get that PCR to work.
Map of 1968 Eco/Bam transfer
DNA payload assembly: Eco/Bam transfer
Redid sbb09,Tn5 3'TR,Romeo G3 PCR with ca998/g00101 with Phu and Expand MM at 55.
Tim's Phusion MM seemed to work better than mine. I'll do a small fragment zymo and digest the PCR product I made with the Phusion MM (on the left). This will need to be digested, along with the following...
| To Eco/Bam digest | Location |
| Bjh2271 | Amy\'s part Box |
| sbb06 | Romeo H3 |
| sbb12 | Romeo F4 |
| jtk2642 | jtkplasmid12 A2 |
| iGEM10_005 | Conor\'s box (using clone #1) |
| iGEM10_010 | Conor\'s box (using clone #1) |
| iGEM10_017 | Perfect parts box |
NOTE: sbb06, sbb12 and the sbb09 PCR product are going to require small Zymo clean-ups!!!
Started digest at 8:00pm.
Gel purified all digests but 1 and 2. I ran the gel for 12 minutes, but that was probably too long for my ~250bp parts. I could barely see the band at 476bp for #4. I'll have to redo the digest tomorrow. Digests are stored in Amy #2.
Amy N. Kristofferson 18:41, 13 September 2010 (EDT)
Ran the following PCRs with ca998/g00101 in Phusion MM 1K55.
| Tube/Lane | Part | ' | Short Descrip | Length |
| 1 | sbb09 | Tn5 3\'TR | 35 | |
| 2 | sbb42 | {rbs_pelB>} | 91 |
Analytical map:
The bands are 2000bp when they should be around 300bp or less. Something weird is going on...
Amy N. Kristofferson 00:17, 12 September 2010 (EDT)
- Miniprepped 51 and 52. They're in my perfect parts box.
Amy N. Kristofferson 15:33, 9 September 2010 (EDT)
- picked colonies off assembly plates. inoculated, checked for co-tranfs
- Daniela miniprepped 42,45,47,48. Map and submit for seq.
- zymo'd SOEing products. Christoph will Eco/Bam digest, gel purify and transfer to pmllCA.
Amy N. Kristofferson 22:12, 8 September 2010 (EDT)
To do:
- Pick colonies of 42, 45, 47, 48.
- Redo assembly of tetR-selflysisL (Bjh2345) to pcon.VBA/B (iGEM10_043/48)
- Transfer stuff from my excel spreadsheet to the igem google doc
- Redo SOEing PCR rxn B. I think I may have cut out the wrong bands...
I still have my digests from my 2345+43/44 assembly, so I'll start from the ligation step. And even though I have sequenced off of tetR promoter yet, I'll also redo the assembly of 42 (tetR-self lysis T) w/ 43/44 while I'm at it. And I'll transform Bjh2017 (SelfLysisT) which is currently in R 1601KC into jtk159 to get rid of the methylation so I can Eco/Bam transfer it into a new vector, in case 42 is messed up.
The following ligations were started at 7:50pm using previously digested products:
Bam/XhoI 2345 + BglII/XhoI 43 and 44 Bam/XhoI 42 + BglII/XhoI 43 and 44
Rescue started at 8:45pm.
Redo of SOEing rxn with A+B
I must have cut out the wrongs bands in my SOEing products, since my Eco/Bam mapping of my minipreps yielded ~3000bp bands... very odd. I remember think the band I was cutting out (from the Zymo product) may have been too low, but the reaction probably worked since the analytical gel I ran before zymoing the products looked liked this:
I don't know what happened between my Zymo and the gel purfication of that Zymo, but I remember the top band being lower than the band in the above picture. Either way, I'm redoing the reaction and cutting out the band at around 6-7K.
Set up the following rxns and ran a 8k55 PCR:
SOEing PCR product A+B for 20his w/ oligos ca998/g00101 SOEing PCR product A+B for 13his w/ oligos ca998/g00101 SOEing PCR product A+B for 131his w/ oligos ca998/g00101
Amy N. Kristofferson 15:15, 7 September 2010 (EDT)
Yesterday, I transformed 51 and 52 into 11.
Also picked colonies from my previous transformation.
Today I'll miniprep everything and submit igem42 (tetR-SL-T)for sequencing.
Miniprepped everything. Some cultures seemed to have lysed, so I ditched their miniprep. I started an analytical Eco/Bam digest at 2:39pm. The tubes are as follows:
1-8: 20b-d, 13a-c, 131c-d
9-12: 1968a,b,d,c (accidently messed up order)
Minipreps are stored in the temporary miniprep box.
Amy N. Kristofferson 17:01, 4 September 2010 (EDT)
Made more Phusion MM.
Ran an analytical gel of the SOEing PCR product and saw multiple bands, so I ran all my Zymo'd product and gel purified the upper bands. Started Eco/Bam digest of three PCR products and Tahoura's 1968 MP at 2:00pm.
Ligated my PCR products with Pmll-AC and Tahoura's with Pmll-KA. Ligation started at 3:35pm. Plate at 4:50pm.
Amy N. Kristofferson 16:48, 3 September 2010 (EDT)
To do tomorrow
- Run analytical gel of SOEing products
- If worked, zymo and Eco/Bam transfer into pmll-CA
- Do Tahoura's Eco/Bam transfer at the same time. The mp's are in my perfect parts box.
- Make more phusion MM for Josh. (dntps in enzyme 2 box in -80)
- Re-transform 45,46,47,48 mps
Sequencing results
| iGEM254 | igem10_045 fwd off tetR | igemten063 | Fairly short read, but the 700bp that read well perfectly aligned with the region of SL after TetR | |
| iGEM255 | igem10_045 rev off pcon | igemten064 | good read, but bad alignment. only about 100bp aligned. very garbled. | |
| iGEM256 | igem10_046 fwd off tetR | igemten063 | Great. 900bp of perfect alignment after tetR. | |
| iGEM257 | igem10_046 rev off pcon | igemten064 | Pretty crappy read. Can\'t infer much from bad alignment. |
Conclusion: igem10_045 probably has large deletions, and I wouldn't be surprised in igem10_046 does too, but I want to resubmit it for sequencing to confirm.
Analytical gel of SOEing A and B PCR products
| Lane | Transposase | SOEing Rxn | Expected length |
| 1 | Tn5 | A | 1452 |
| 2 | SB | A | 1454 |
| 3 | PB | A | 1449 |
| 4 | Tn5 | B | 5046 |
| 5 | SB | B | 5002 |
| 6 | PB | B | 5860 |
They all look great!
Second step of SOEing
I'm going to Zymo all of the PCR products, elute with 33uL (PCR was 36uL, I used 3uL for the analytical gel), and then use 1uL of A and B for template in the next PCR along with 1uL of ca998 and g00101.
Ran 8K55 PCR. Tubes are labelled 1-20, 2-13, 3-131.
Amy N. Kristofferson 17:32, 2 September 2010 (EDT)
SOEing Histags with linkers in front of Transposases
The previous oligos I designed to do this by quikchange didn't include linker scar sequences after pelB or before the transposase. This could have hindered proper folding of the protein due to decreased flexibility.
| igemTen065 | gccggcgatggccGGATCTcatcatcatcatcatcatggatctATAACTTCTGCTCTTCA | 60 | fwd Quick change his6tag into iGEM10_020 WITH SCAR |
| igemTen066 | TGAAGAGCAGAAGTTATagatccatgatgatgatgatgatgAGATCCggccatcgccggc | 60 | rev Quick change his6tag into iGEM10_020 WITH SCAR |
| igemTen067 | cggcgatggccGGATCTcatcatcatcatcatcatggatctGGTAAATCTAAAGAAATCT | 60 | fwd Quick change his6tag into iGEM10_013 WITH SCAR |
| igemTen068 | AGATTTCTTTAGATTTACCagatccatgatgatgatgatgatgAGATCCggccatcgccg | 60 | rev Quick change his6tag into iGEM10_013 WITH SCAR |
| igemTen069 | gccggcgatggccGGATCTcatcatcatcatcatcatgGATCTGGTTGCTCTCTGGA | 57 | fwd Quick change his6tag into iGEM10_131 WITH SCAR |
| igemTen070 | TCCAGAGAGCAACCAGATCcatgatgatgatgatgatgAGATCCggccatcgccggc | 57 | rev Quick change his6tag into iGEM10_131 WITH SCAR |
Note: igemten067 may not work... just notice that the mp of the right homologous region is only 46*. Don't know how that happened... maybe try 45 too?
Ah... there's a scar seq in btwn pelB and the transposase which will be included in the annealing region... This bumps up the annealing Tm a bit.. I think I'll run everything at 50 and 55deg.
Note: Phusion is more efficient, but expand is better for genomic DNA.
SOEing Reaction A
| Transposase | Goal Part | Template | Oligos | PCR program | Expected length |
| Tn5 | iGEM10_152 | igem10_020 | ca998/igemTen066 | 2K55 | 1452 |
| SleepingBeauty | iGEM10_153 | igem10_013 | ca998/igemTen068 | 2K55 | 1454 |
| PiggyBac | iGEM10_154 | igem10_131 | ca998/igemTen070 | 2K55 | 1449 |
SOEing Reaction B
| Transposase | Goal Part | Template | Oligos | PCR program | Expected length |
| Tn5 | iGEM10_152 | igem10_020 | igemTen065/g00101 | 6K55 | 5046 |
| SleepingBeauty | iGEM10_153 | igem10_013 | igemTen067/g00101 | 6K55 | 5002 |
| PiggyBac | iGEM10_154 | igem10_131 | igemTen069/g00101 | 6K55 | 5860 |
Checking Self-Lysis
From meeting notes email:
use the following oligos to sequence off 45,46,47,48 to check to see if self-lysis is intact igemTen063 GATGCTGTAGGCATAGGCTTGG 22 igemTen064 GCTAGCAAAGTGCCTAGGAC 20 Rev off selflysis (pCon) also sequence self-lysis on transposase? (igemten63 would work as forward..., would have to design another rev oligo)
I'm out of 047 and 048, so I'll have to re-transform if I want more of it.
In the meantime, I'll submit 45 and 46 for sequencing w/ igemten063 and 064.
Amy N. Kristofferson 17:11, 16 August 2010 (EDT)
To do:
- Miniprep gibson's
- Figure out how to redo Quikchange for 13, 131
- Figure out whether or not and how to redo pjc012 insertion w/ sbb10 (or maybe its just toxic?)
Tomorrow:
- Analyze self-lysis results from Tecan
- submit 45-52 for sequencing to make sure self lysis is fully there
- transform selflysis L and T under pbad and ptet and test for lysis.
Miniprepped sbb04(10?) and igem55 in jco12 samples a-b over the weekend as well as igem10_020 his6 quikchange samples a-d.
Set up the following analytical digests at 2:05pm:
Mapping of sbb04 and sbb55 in jco12.
Bgl/XhoI of sbb04: 5543, 1958 Bgl/XhoI of iGEM10_55: 5543, 1634
(if 04 and 10 were switched and what was labeled 4 was actually 10... expected lengths= 5543 and 1196)
Mapping of Quik change his6tag onto 20a. Eco/Bam: about 6300 and 2700
sbb04: all bad sbb55: all bad My Quikchange of 20: b and c look good
Amy N. Kristofferson 14:07, 13 August 2010 (EDT)
To do on saturday:
- Pick colonies off Gibson plate. Run colPCR. I'll need someone to do a miniprep on Sunday.
(or just pick colonies on Tuesday)
- Miniprep his-tag inoculations. Map and submit for sequencing.
Gibson
Analytical gel.
Expected lengths for gibson:
Lanes 1,2,5,6: 741bp
Lanes 3, 4, 7, 8: 5750bp
For reaction a, reaction tube 2 and 6 look good. I'll use 6. For reaction b, reaction tube 4 and 8 look good. I'll use 8.
Since bands are of fairly equal brightness, I used 5uL of b8 and 1uL of a6 elutions. Put reaction in thermocycler at 50oC for 1hr.
Transformed jtk030 cells and plated on Amp.
His-tagged Transposase
Colony check:
jc012 vector insertion: several colonies grew on igem10_055 and sbb04. The plates were Amp, though, so there's a bit of fuzzy background. I'll try to pick the center of the large colonies and grow them up in Amp.
Quikchange:
I only got seven colonies on igem10_020 and nothing on 13 or 131. I'll grow up the colonies in AC and miniprep them tomorrow.
What should I do about the ones that didn't work? Options:
- Redo it starting with my final PCRs (Dpnl incubation and transformation)
- Redo it starting at the very beginning
- Design new oligos
- Do gibson?
Amy N. Kristofferson 13:56, 12 August 2010 (EDT)
For tomorrow:
- analytical map of Gibson PCRs
- Perform the super mysterious Gibson incubation
- Pick colonies from quikchange plate (grow up in LB-AC), colpcr, no cotransf
- Pick colonies from joc12 plate (grow up in LB-A), colpcr, no cotransf (part from PCR)
Update: the strains we were using (jtk030, Righty and Lefty)contain pir under a ptet promoter. So all of our constructs in PMLL (R6K) with parts under tetR were being produced at a low copy number, since the tet repressor was also repressing pir. PLUS they were leaky because the repressor was busy repressing pir in addition to whatever construct (mostly self lysis) that we had under tetR.
Plan of action:
Tim's going to transform 45-52, 20, 13 and 131 into Josh's jtk159 strain, which is pCon-pir. The only thing is that the pir doesn't have a stop codon, but it has proven to still be functional and produce a fairly good copy number.
I'll redo the lysis and transposase assays. I need to plan the assays on saturday, so I can tell Tim how much of what media to grow everything up in for Monday's tests.
Transposase Purification
Quikchange
Added Dpnl to all three reactions and put in incubator at 10:56am.
Transformed into jtk030. Started rescue at 12:30pm.
pjc012 transfer
Started ligation of Bgl/XhoI digested transposase (igem10_055, sbb10, sbb04) to Bam/XhoI digested jc012 at 11:17am.
Note: the labels of the transposase digests are a little confusing. I may have switched up piggybac and sleeping beauty. I'll figure it out when I map/sequence them.
Transformed into jtk030 (safe for colE1). Started rescue at 12:30pm. Don't need to rescue b/c plasmid is amp, but I'll just plate it at the same time.
Gibson
Oligos came in today. I set up the following reactions:
reaction oligo template a 60, 61 ffGFP (jtk2541-pBca9523) b 62, 59 NLS in jco12 (1884+1858 in jco12, fd--see iGEM214 sequencing result)
I'm going to try Phusion and Expand at 45 and 55 for both reactions.
| Tube | Reaction | 6K55/45 | Expand/Phusion |
| 1 | a | 55 | Expand |
| 2 | a | 55 | Phusion |
| 3 | b | 55 | Expand |
| 4 | b | 55 | Phusion |
| 5 | a | 45 | Expand |
| 6 | a | 45 | Phusion |
| 7 | b | 45 | Expand |
| 8 | b | 45 | Phusion |
Expected product for a:
(741bp)
atcccgactaccgaaaacctgtacttccagCGTAAAGGCGAAGAGCTGTTCactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggt gacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaa
Expected product for b:
(5750bp)
catcacgcatggtatggatgaactgtacaaaCCGCCGAAAAAAAAACGTAAAGTTtaacTCGAGTGATCAatccggctgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggatatcccgcaagaggcccggcagtaccggcataaccaagcctatgcctacagcatccagggtgacggtgccgaggatgacgatgagcgcattgttagatttcatacacggtgcctgactgcgttagcaatttaactgtgataaactaccgcattaaagcttatcgatgataagctgtcaaacatgagaattcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgcagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatcattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacaccgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtatacactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacgcgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgtggtcgtgaagcgattcacagatgtctgcctgttcatccgcgtccagctcgttgagtttctccagaagcgttaatgtctggcttctgataaagcgggccatgttaagggcggttttttcctgtttggtcactgatgcctccgtgtaagggggatttctgttcatgggggtaatgataccgatgaaacgagagaggatgctcacgatacgggttactgatgatgaacatgcccggttactggaacgttgtgagggtaaacaactggcggtatggatgcggcgggaccagagaaaaatcactcagggtcaatgccagcgcttcgttaatacagatgtaggtgttccacagggtagccagcagcatcctgcgatgcagatccggaacataatggtgcagggcgctgacttccgcgtttccagactttacgaaacacggaaaccgaagaccattcatgttgttgctcaggtcgcagacgttttgcagcagcagtcgcttcacgttcgctcgcgtatcggtgattcattctgctaaccagtaaggcaaccccgccagcctagccgggtcctcaacgacaggagcacgatcatgcgcacccgtggccaggacccaacgctgcccgagatgcgccgcgtgcggctgctggagatggcggacgcgatggatatgttctgccaagggttggtttgcgcattcacagttctccgcaagaattgattggctccaattcttggagtggtgaatccgttagcgaggtgccgccggcttccattcaggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcggcgcctacaatccatgccaacccgttccatgtgctcgccgaggcggcataaatcgccgtgacgatcagcggtccagtgatcgaagttaggctggtaagagccgcgagcgatccttgaagctgtccctgatggtcgtcatctacctgcctggacagcatggcctgcaacgcgggcatcccgatgccgccggaagcgagaagaatcataatggggaaggccatccagcctcgcgtcgcgaacgccagcaagacgtagcccagcgcgtcggccgccatgccggcgataatggcctgcttctcgccgaaacgtttggtggcgggaccagtgacgaaggcttgagcgagggcgtgcaagattccgaataccgcaagcgacaggccgatcatcgtcgcgctccagcgaaagcggtcctcgccgaaaatgacccagagcgctgccggcacctgtcctacgagttgcatgataaagaagacagtcataagtgcggcgacgatagtcatgccccgcgcccaccggaaggagctgactgggttgaaggctctcaagggcatcggtcgagatcccggtgcctaatgagtgagctaacttacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgccagggtggtttttcttttcaccagtgagacgggcaacagctgattgcccttcaccgcctggccctgagagagttgcagcaagcggtccacgctggtttgccccagcaggcgaaaatcctgtttgatggtggttaacggcgggatataacatgagctgtcttcggtatcgtcgtatcccactaccgagatatccgcaccaacgcgcagcccggactcggtaatggcgcgcattgcgcccagcgccatctgatcgttggcaaccagcatcgcagtgggaacgatgccctcattcagcatttgcatggtttgttgaaaaccggacatggcactccagtcgccttcccgttccgctatcggctgaatttgattgcgagtgagatatttatgccagccagccagacgcagacgcgccgagacagaacttaatgggcccgctaacagcgcgatttgctggtgacccaatgcgaccagatgctccacgcccagtcgcgtaccgtcttcatgggagaaaataatactgttgatgggtgtctggtcagagacatcaagaaataacgccggaacattagtgcaggcagcttccacagcaatggcatcctggtcatccagcggatagttaatgatcagcccactgacgcgttgcgcgagaagattgtgcaccgccgctttacaggcttcgacgccgcttcgttctaccatcgacaccaccacgctggcacccagttgatcggcgcgagatttaatcgccgcgacaatttgcgacggcgcgtgcagggccagactggaggtggcaacgccaatcagcaacgactgtttgcccgccagttgttgtgccacgcggttgggaatgtaattcagctccgccatcgccgcttccactttttcccgcgttttcgcagaaacgtggctggcctggttcaccacgcgggaaacggtctgataagagacaccggcatactctgcgacatcgtataacgttactggtttcacattcaccaccctgaattgactctcttccgggcgctatcatgccataccgcgaaaggttttgcgccattcgatggtgtccgggatctcgacgctctcccttatgcgactcctgcattaggaagcagcccagtagtaggttgaggccgttgagcaccgccgccgcaaggaatggtgcatgcaaggagatggcgcccaacagtcccccggccacggggcctgccaccatacccacgccgaaacaagcgctcatgagcccgaagtggcgagcccgatcttccccatcggtgatgtcggcgatataggcgccagcaaccgcacctgtggcgccggtgatgccggccacgatgcgtccggcgtagaggatcgagatctcgatcccgcgaaattaatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactttaagaaggagatataccatgggccatcaccatcaccatcacgactacgacatcccgact
Amy N. Kristofferson 17:37, 11 August 2010 (EDT)
End of 1884+1858 project, beginning of histag-GFP-NLS Gibson project
News flash: sequenced the fwd region of igem10_141 (RFP-NLS construct) and found that there's a pelB in front of the part. This could be a problem b/c RFP may not fold in the periplasm. I'm going to add IPTG to a liquid culture and see if it turns red.
His tag will get cleaved off along w/ pelB, so we need to design an oligo to remove pelB from the front of RFP.
Designed the following oligos to set up a Gibson reaction that would ultimately make {<ffGFP>}{<NLS!} in pjc012.
Junction plasmid w/ <ffGFP>
igemten059 Rev (last 20bp of histag on jc012): ctggaagtacaggttttcggt
igemten060 Fwd (last 30bp of histag, first 20bp of ffGFP minus atg)atcccgactaccgaaaacctgtacttccagCGTAAAGGCGAAGAGCTGTTC
Junction <ffGFP> w/ <NLS! in jc012:
igemten061 Rev (last 20bp of ffGFP, minus tga): tttgtacagttcatccataccatg
igemten062 Fwd (last 30bp of ffGFP, first 20bp of NLS): catcacgcatggtatggatgaactgtacaaaCCGCCGAAAAAAAAACGTAAAG
Transposase Quikchange
Set up quikchange reaction:
I have to set up 6 reactions, so I'll make the following times 8:
5 ul 10X pfu buffer (supplied with pfu turbo enzyme) 1 ul 10 mM dNTP mix 1 ul Pfu turbo polymerase 41uL H2O (to bring to 50uL) All of the above x8 makes for: 40 ul 10X pfu buffer (supplied with pfu turbo enzyme) 8 ul 10 mM dNTP mix 8 ul Pfu turbo polymerase 328uL H2O (to bring to 50uL) I'll measure out _uL and add 1 ul 10 uM primer .1-.2ug plasmid template (1 ul miniprep)
| Tube | Template | Oligo |
| 1 | igem10_020 | igemten052 |
| 2 | igem10_020 | igemten053 |
| 3 | igem10_013 | igemten054 |
| 4 | igem10_013 | igemten055 |
| 5 | igem10_131 | igemten056 |
| 6 | igem10_131 | igemten057 |
Amy N. Kristofferson 18:32, 10 August 2010 (EDT)
Adding His6tag to Transposases with Quikchange
My oligos:
igemTen052 cagccggcgatggccGcatcatcatcatcatcatgatctATAACTTCTGCTCTTCATCGT 60 fwd Quick change his6tag into iGEM10_020 igemTen053 ACGATGAAGAGCAGAAGTTATagatcatgatgatgatgatgatgCggccatcgccggctg 60 rev Quick change his6tag into iGEM10_020 igemTen054 ccggcgatggccGcatcatcatcatcatcatgatctGGTAAATCTAAAGAAATCTCTCAG 60 fwd Quick change his6tag into iGEM10_013 igemTen055 CTGAGAGATTTCTTTAGATTTACCagatcatgatgatgatgatgatgCggccatcgccgg 60 rev Quick change his6tag into iGEM10_013 igemTen056 gccggcgatggccGcatcatcatcatcatcatGATCTGGTTGCTCTCTGGA 51 fwd Quick change his6tag into iGEM10_131 igemTen057 TCCAGAGAGCAACCAGATCatgatgatgatgatgatgCggccatcgccggc 56 rev Quick change his6tag into iGEM10_131
Procedure is here:
I want to set up the following reaction:
| Transposase in Construct | Part number | Oligos |
| Tn5 | igem10_020 | igemTen052, 53 |
| Sleeping Beauty | igem10_013 | igemTen054, 55 |
| PiggyBac | igem10_131 | igemTen056, 57 |
Mapping/Sequencing of 1884+1858 in jc012
Bgl/XhoI digest started at 3:30pm.
Sequencing submission: with oligos igemten58 and g00101.
Bgl/XhoI: 5543, 881
I'm going to submit f,b for sequencing.
Amy N. Kristofferson 17:09, 9 August 2010 (EDT)
Designed oligos for quikchange to add in His6tag. I'm going to wait to ligate my pcr product digest with mike's plasmid digest so I can do it in parallel with my quikchange transformation. Those colonies probably won't be stable for very long since the transposase will be expressed in the cytoplasm.
End of SL/VB Assembly
Sequencing results allowed me to add the following parts to my perfect part box: igem10_045a, igem10_049a, igem10_050c. I'm going to run a Tecan assay to compare lysis of the T-lysozyme version to the L-lysozyme version.
Today, I'll transform jtk030 cells with the minipreps so I can run a Tecan assay comparing the T4 and Lamba lysozyme versions of self-lysis as well as do a macro test to see if they all work in TB, LB, sea water.
Started rescue at 7:45pm.
Redo Map of 1884+1858
Eco/Bam digest of 1884+1858 combo minipreps (e and f a-b) Started at 2:206pm
Eco/Bam digest resulted in one band. Forgot that I destroyed the Bam site with ligation of Bam/Bgl sticky ends.
Amy N. Kristofferson 12:10, 8 August 2010 (EDT)
To do:
- design oligos for quikchange
- design oligos for fwd sequence off mike's plasmid
- ligate digested PCR products of transposases w/ XhoI sites to Mike's plasmid.
- check self lysis assay plates
Amy N. Kristofferson 14:45, 6 August 2010 (EDT)
To do:
- transform self-lysis assay cells
- map f (digest, gel)
- digest 1,2,3 (ligate and transform?)
- design oligos for quikchange
- sequence analysis for 41/42 stuff
Rescue for SL assay started at 3:35pm. Transformed Righty cells (they just needed to be pir+)
Started Eco/Bam mapping redo of 1884+1858 in jco12 F,d at 2:44pm. The gel came up empty :(
GenR check: I streak cells containing igem10_013, 020, and 131 on Gen plates and lots of colonies grew up on all of them. GenR is present and functions in the constructs! wooo
Self-Lysis Assay: Testing the SL devices on the Transposase Constructs in TB, LB, sea water, transposition buffer
Here's how the plates are labeled:
| ' | iGEM10_20 (with atc) | iGEM10_20 (no atc) | iGEM10_013 (with atc) | iGEM10_013 (no atc) | iGEM10_131 (with atc) | iGEM10_131 (no atc) |
| Transposase Buffer (NEB2, 150mM MgCl2, pH 7.5) | 19 | 20 | 21 | 22 | 23 | 24 |
| Sterilized Sea Water | 13 | 14 | 15 | 16 | 17 | 18 |
| LB | 7 | 8 | 9 | 10 | 11 | 12 |
| TB | 1 | 2 | 3 | 4 | 5 | 6 |
Procedure:
- Grew up 10mL of two colonies off the plates for igem10_020, 013, and 131
- Used 8mL of those cells by filling 4 collection tubes with 2mL of cells. Spun them down and disposed of supernatant.
- Resuspended one of each in TB, LB, Sea water, and Transposase Buffer.
- Divided each of the 12 2mL sample into two wells on a 24 well plate.
- Added 1uL of atc to one of the 1mL samples from each 2mL sample. See detailed layout of plate above.
- Moved plate to 37deg shaker. Let sit for 1hour.
- Transfered 200uL of cells from each well to an eppendorph tube and spun down the cells. Transfered supernatant to Zymo Columns.
- Performed a zymo. Note: used 800ul of ADB to meet the necessary 1:4 ratio. Eluted with 10uL.
- Put tubes on ice. Transformed a huge batch of Righty cells (pir +). Added 70uL of cells to each tube.
- Heat shocked, added 100uL of 2YT, let rescue for ~10min before realizing the plasmids are AC and I could just plate on Amp.
- Plates are currently stored in incubator labeled 1-24 according to the layout above.
His-tag addition to Transposases
PCR Isolation of Transposases
Conor set up the following three pcr's yesterday. They were run on 2K55:
| Well | Name | Vector | Target Part | Fwd Oligo | Rev Oligo | Expected Size |
| 1 | iGEM10_055 | KA | <tn5>{<NIS!} | ca998 | igemTen048 | 1530 |
| 2 | sbb04 | KA | <piggyBac! | ca998 | igemTen050 | 1850 |
| 3 | sbb10 | KA | <SB100x! | ca998 | igemTen051 | 1100 |
Here's my analytical gel:
Each PCR looks perfect! I'm going to start assembly.
Digests stored in Amy #2.
Started Bgl/XhoI digest of each at 2:38pm.
Amy N. Kristofferson 13:28, 5 August 2010 (EDT)
Yesterday's Assay failed. No colonies grew.
We're going to do a self-lysis assay tomorrow to trouble shoot. Picked two colonies of iGEM20, 13, and 131 and inoculated in 10ml LB-AC.
Also, streaked each on Gen, just to make sure GenR cassette is functioning.
Miniprep Mapping: 1884+1858 in jc012 and 41/42+43/44 samples
1884+1858 in jc012: Eco/Bam should give 712 and 5713bp.
igem10_045 Eco/Bam: 5548,
igem10_046d from the first assembly sequenced well, so I won't map any of the minipreps
igem10_049 Eco/Bam: 5578
igem10_050 Eco/Bam: 6347
Eco/Bam digest started at 3:46pm.
I ran the gel too long, but I'm going to submit the first one for sequencing. Hopefully I have oligos I can use...
Minipreps of 9145-1144
Made 8 and put them in Amy #2.
Amy N. Kristofferson 13:53, 4 August 2010 (EDT)
Minipreps
None of the 1884/1858 samples were cotransformed, but out the the 41/42+43/44 samples, 41+44b and 42+44a were cotransformed.
I miniprepped everything else.
Transposase Assay: Testing Sleeping Beauty and Tn5 in NEB2+MgCl2, varying [DNA] and activity time
Transposition Buffer: Added 1.0165mg to each mL of NEB2 (MgCl2 tetrahydrate is 203.3g/mol and we're attempting to copy a transposition buffer that contains 150mM of MgCl2). We added 36.6mg of MgCl2 to 32.4mL of water and 3.6mL of 10xNEB2 to make 150mM MgCl2 NEB2. We also added 5 drops of diluted HCl (tube labeled diluted HCl... we made it my dipping a pasteur pipette in the 12M HCL and then in 50mL of mgH20) to bring the pH from 7.8 to 7.6 or so.
Spun down all 5mLs of cells and 1uL of control cells (no ara). Resuspended in NEB2+MgCl2 buffer. Transferred control into a tube. Combined all 5mL resuspended cells into one tube, and then separated into 5 tubes.
Added 1uL of atc and 10uL of arabinose to each mL of cells at 1:05pm. Put in 37deg shaker.
Started adding DNA at 1:40pm. For DNA, we mixed two minipreps of 9145-1144. Well, we mixed them after adding DNA from one of the MPs to the 1uL tubes and the 13 .5uL tube (Whoops).
Somehow, we ran out of MP, so we're only adding up to 10uL of DNA.
Time points:
.5hr- 2:10pm
1hr- 2:40pm
1.5hr- 3:10pm
2hr- 3:40pm
Transform into TG1 cells. We mixed 11 tubes of TG1 cells together in a Falcon tube.
Self Lysis Test in NEB2+MgCl2
With bacteria grown up from another colony for Transposase Assay (Arabinose added last night around 5:30pm), with took 2mL, spun then down and resuspended in our NEB2+MgCl2 buffer. I divided the 2mL into 2 tubes and added 10uL of arabinose (just to keep it similar to the above experiment) and 1uL of atc to one of them.
We'll let it sit in the shaker for 1 hr, and then we'll spin down the cells, zymo the supernatant, transform jtk030 (pir+) cells and them plate on Gen. 1:24pm.
Transposase Purification
Literature search:
Tn5: N-terminus (1)
PiggyBac: N-terminus (2)
Sleeping Beauty:
(1)http://www.springerlink.com/content/u0011pj34254227h/fulltext.pdf
"Transposase: The transposase is a hyperactive triple-mutant version of the Tn5
transposase. The mutations are at residues 54 (E to K), 56 (M to A) and 372 (L to
P) (1). The enzyme can be purchased from Epicentre Technologies (see Note 1).
N-terminal His-tagged and maltose-binding protein-fusion versions of the
hyperactive transposase have also been constructed and used successfully (Yigit,
H. and Reznikoff, W. S., unpublished) (18)."
(2)http://www.nature.com/mt/journal/v15/n1/pdf/6300028a.pdf "We added a hemagglutinin (HA) epitope tag to the N-terminus of the piggyBac transposase and demonstrated no effect on transposition activity compared with the native enzyme (data not shown)."
In Vitro Reaction Conditions:
For a typical reaction, 2 μl (approximately 0.2 μg of protein/μl) of Tnp was added to 18 μl of pRZTL1 plasmid (approximately 1 μg of DNA) in the transposition reaction buffer (0.1 M potassium glutamate, 25 mM Tris acetate, pH 7.5, 10 mM Mg2+acetate, 50 μg/ml bovine serum albumin, 0.5 mMβ-mercaptoethanol, 2 mM spermidine, 100 μg/ml tRNA; final concentrations). The reaction was incubated for 1 h at 20 °C and then diluted 2–3-fold in the same buffer and transferred to 37 °C. This procedure was performed to facilitate binding in the presence of CHAPS present in the reaction mixture as a component of the Tnp storage buffer (TEGX, 10 mM CHAPS). Dilution increased the cleavage reaction presumably due to dilution of CHAPS. CHAPS can be eliminated from the reaction (and storage buffer), and a simple incubation at 37 °C with no dilution is satisfactory if Qiagen-purified DNA is used. We nevertheless used the above two-step procedure for all experiments to synchronize the start of cleavage.
(from "Tn5 in Vitro Transposition" http://www.jbc.org/content/273/13/7367.full)
Add N-terminus, cleavable his6tag to Tn5 transposase:
design oligo to add xhoI site immediately after self-lysis device. PCR off igem 19, 103, 104 (sequence 103 and 104 first?) w/ ca998 and above oligo. Bgl/XhoI PCR product into Mike's vector.
igem10_019: <tn5>{<NIS!}b1006Tn5 5'TRPromoter_rbs_GenRTn5 3'TRSelf_Lysis_Device
igem10_103: <piggyBac!b1006piggieBac_5'TRPromoter_rbs_GenRpiggieBac3'TRSelf_Lysis_Device
iGEM10_104: <SB100x!b1006sleeping_beauty_5'TRPromoter_rbs_GenRsleeping_beauty_3'TRSelf_Lysis_Device
Other interesting info:
Sleeping Beauty may contain an internal NLS: http://www.nature.com/mt/journal/v9/n2/pdf/mt200424a.pdf
Amy N. Kristofferson 19:09, 3 August 2010 (EDT)
I picked four colonies of each of the 41/42 and 43/44 combinations (a good number of colonies grew up on all of the plates) and four colonies of the restreaked 1884+1858 in jc012 vector. I checked them all for cotransformation, but skipped the colPCR since the parts are so large and jco12 doesn't have ca998/goo101.
Conor and I also picked colonies in order to set up for the Transposase Assay tomorrow. We're going to perform the assay in the following buffer's:
Transposition Reaction Buffer 10×transposition buffer (100 mM Tris, pH 7.5, 150 mM MgCl2, 100 mM KCl, 10 mM DTT)
NEB2 1X
10 mM Tris-HCl, 10 mM MgCl2, 50 mM NaCl, 1 mM DTT (pH 7.9 at 25°C)
(need to add salt, adjust pH to 7.5 and add MgCl2)
Phosphate Buffered Saline
10X Solution
1.37M Sodium Chloride, 0.027M Potassium Chloride, and 0.119M Phosphate Buffer
Make 150 mM MgCl2.
Set pH at 7.5pH
Oligos ordered:
igemTen050 gctagCTCGAGttaGAAGCAAGACTGGCACATG 33 rev xhoI piggybac
igemTen051 gctagCTCGAGTTAGTATTTGGTAGCGTTACCTTTGAA 38 rev xhoI sleeping beauty
For Tn5, I can use the oligo I designed to go off the NLS:
igemTen048 gctagCTCGAGttaAACTTTACGTTTTTTTTTCGGCGG 38 rev xhoI 1858 {<NLS!}
Here are the PCR reactions I'll have to set up:
Amy N. Kristofferson 14:30, 2 August 2010 (EDT)
To do:
- map 46/49 minipreps
- Submit good one for sequencing
- redo assembly for 47/52 (or whatever they are)
- Pick green colonies off 1858+1884 plates, inoculate, check for co-transf. (can't do ca998 colPCR)
- design quik change oligos (C or N terminus?)
- write up results from Tecan toxicity test for igem10_20
- ef1a/atub stuff
Results from Tn5 Toxicity Assay
If Tn5 is actually being expressed over the course of these 6 hours, then these results would suggest that it's not toxic, since the OD isn't dropping, suggesting death and lysis, but is gradually increasing as the bacteria continue to grow slowly. One of the samples has the same curve but is shifted down, which is probably a result of inaccurate pipetting, which lead to a lower starting OD. As expected, the OD of my controls LB and LB+ara, are low and constant.
Notes for Transposase Assay
pbad-transposase-tr-gen-tr-self lysis (no zf)
tn5: igem10_020, igem10_117 piggybac: igem10_131 sleeping beauty: igem10_134 (not made yet)
Streaking dilution of 1884+1858 in pjc012
I'll pick colonies tomorrow, miniprep and sequence on Wednesday.
Map of 46 and 49
Started Eco/Bam digest at 11:29am.
Lane 1-3: 46 c,d,g Expected lengths: 6117, 2877
Lane 4-6: 49 a,b,c Expected lenghts: 5778, 2877
46d and g look good. None of 49 look good.
I submitted 46d and 49a for sequencing.
Redo Assembly of 45 and 50
Redo of digests, using NEB3 buffer instead.
42+43=45
41+44=40
Bgl/XhoI digest of 43 and 44
Bam/XhoI digest of 41 and 42
Started at 12:12pm.
Since my minipreps are all over the map, I'm going to redo all combinations of 41/42+43/44.
Ligation started at 2:08pm.
Started rescue at 3:22pm.
Amy N. Kristofferson 02:05, 2 August 2010 (EDT)
1884+1858 in jc012 restreaking
Since these plates made lawns with only a few tiny green colonies, I went back and swabbed the area of the plate with a green colonies and dipped it in 100uL of 2YT and then plated all the 2YT on Amp. Hopefully this will give me larger, isolated green colonies.
Amy N. Kristofferson 14:21, 29 July 2010 (EDT)
To do:
- MP 41/42 stuff.
- Map minipreps
- Submit for sequencing
- Pick colonies off 9145-1144
Background:
- Look into adding his-tags to transposases for purification
- Look into buffers that optimize transposase activity
iGEM10_046 and 051 Assembly analysis
ColPCR
lanes 1-8: 42+44 (iGEM10_046) expected length: 6317bp Perfect: 4,7 MP: 4,7
lanes 9-12: 41+43 (iGEM10_049) expected length: 5978bp Perfect: 4 MP: 1,2 (4 was cotransformed)
Cotransformation results: Only 41+43d was cotransformed. Unfortunately, d was the only one that looked good on the colPCR. Oh well.
Miniprepped:
42+44: c,d,g (labeled 46c,d,g for iGEM10_046)
41+43: a,b,c (labeled 49a,b,c for iGEM10_049)
Tecan Assay: Testing Self-Lysis timing of 047/048 in LB and Toxicity of 020
Assembly of 1888+1858 with Mike's plasmid
Messed up yesterday's assembly, and realized I don't need to gel purify the digest of Mike's plasmid, because I'll be able to select for the correct plasmids, since the colonies will be green So I set up the following:
Bgl/XhoI digest of 1884+1858 e,f eluted PCR products
Bam/XhoI digest of Mike's plasmid (mel001 in pJco12)
Started at 12:55pm.
Ligation started at 2:20pm.
Transformed jtk030 cells and plated on amp.
Amy N. Kristofferson 14:10, 28 July 2010 (EDT)
To do:
- Pick colonies off of 41/42+43/44 plates
- Pick colonies for Tecan assay tomorrow (see Tim's email)
41/42+43/44 plates Analysis and colony picking
42+44: 18 colonies
42+43: 0 colonies
41+44: 0 colonies
41+43: tons of colonies
I'll pick 8 colonies off 42+44 (I have a feeling a lot of them are co-transformed), and 4 colonies off 41+43. Inoculate in LB-AK, colPCR?, streak on triple antibiotics.
Ran a 7KcolPCR
Restock 9145-1144
Transformed jtk030 cells.
1884+1858 ca998/iGEM048
Expected length: ~700bp. They all look great!
I'll also digest Mike's plasmid (Mel001 p3co12) with Bam/XhoI. Started at 2:14pm.
Even though I haven't gotten sequencing results back, I'm going to digest sample c and d with Bgl/XhoI. Digest started at 3:06pm. Gel purified. Expected lengths: 700bp dropout, vector should be ~5700bp. (Single cut would produce ~6400bp) Hopefully the gp worked well... I cut out the upper band, which was too high to really distinguish the length.
Ligation started at 5:29pm.
Transformed jtk030 cells.
Found my digests in the incubator. Turns out I used the undigested eluted PCR product for the assembly. Whoops. Trashed the cells. I'll redo the digestion+ligation tomorrow.
Transposase Assay: Testing Transposase Expression time and Activity Time
- Day before, add one colony to 6mL of LB-CK.
- Day of assay, move 1000uL of cells into five flasks (can discard extra mL)
- Add 10uL of arabinose for each mL of cells at t=o, 1 hour, 2 hours, 3 hours
- t=0 was 10:58am. I added 10ul of ara to the tube marked t=0.
- t=1 was 11:56am. I added 10uL of ara to the tube marked t-1.
- t=2 was 12:58pm.
- t=3 was 1:58pm.
- After four hours have passed since you first added arabinose (3pm), add 1uL of atc per mL of cells. Allow 1 hour for lysis.
- Added 1uL of atc to every tube but the control at 3:00pm.
- After that one hour, add 3uL of 9145-1144 DNA to each tube.
- Added DNA at 4:00pm. There was no visible sign that the cells had lysed.
- Remove a 200uL sample of lysate after 30min, 1 hour, 1.5hour, 2hours.
- 4:30, 5, 5:30, 6pm (NOTE: I may have forgotten to add ADB to the lysate for the 5:00pm sample... I can't remember)
- Immediately after removal, spin down the lysate and zymo the supernatant.
- Transform lefty pir+ cells with the lysate. Plate on Amp and Gen.
Need to transform cells w/ 9145-1144 so we can get more DNA.
Transformed TG1 cells.
Rough test of Self Lysis Timing in TB
Yesterday, I inoculated iGEM10_047 and 048. I put 1 mL of each into two tubes, so I have a control tube and a tube to add atc to, with all the cells derived from one colony pick.
Added 1uL of Conor's 1000x atc at 11:25am. At 12:25pm, the cells still do not appear to have lysed.
Check cells at 11:55am. Based on visual inspection, there appears to be no change in OD.
Checked cells again at 1:00pm. The cells in 47 have clearly lysed, but it doesn't appear that the 48 cells have lysed yet.
Pictures:
47 (w/o tip) Left=control, right=atc 48 (w/ tip) left=control, right=atc.
Sequencing Results
iGEM10_042a is perfect. (ca998 sequencing redo produced a perfect partial)
Degradation Assay
Conor will do this tomorrow:
Add 1uL of atc to each 1mL sample of cells. Let cells lyse for an hour. Add 1uL of DNA. At each of the following intervals: 15min, 30min, 45min, 1 hour, 1.5, 2, 2.5, 3, remove 200uL of DNA, spin down, and zymo supernatant. After you have all your zymo'd samples, plate on Amp.
Amy N. Kristofferson 14:25, 27 July 2010 (EDT)
To do:
- Grow up Payload delivery colonies in TB
- Grow up transposase colonies
Picked two colonies of jtk030 cells transformed with iGEM10_047 and 048 and put them in TB-KA in the shaker upstairs. Tomorrow, I'll see how long it takes for the cells to undergo self-lysis. Each part has the exact same SL device under the same Ptet promoter, so they shouldn't vary.
PCR off 1884+1858 in 1601CK
I designed an oligo that will add a XhoI site to the NLS. So if I do a PCR with ca998 and my oligo igemTen048, hopefully I should get a band around 733bp long. I should only get this band if NLS is after RFP. It can't PCR off just RFP, because there would be no NLS to bind to. And just NLS is only 33bp, so that wouldn't even show up on the gel. Ran a 2K55.
Mapping of 1884 and 1858
I wasn't going to map these, but since sequencing of 1884+1858 a and b w/ g00101 both failed, I'm going to map them. The maps won't show whether or not the NLS tag is there, but it should show how good the MP is and if the backbone is good.
Eco/Bam Digest started at: 12:30pm
Expected lengths: 3142 (vector), 711 (part)
Lanes 1-8 correspond with samples a-h.
Everything looks good. They could have had bad reads because they were cotransformed. I submitted 1884+1858c and d for sequencing.
Sequencing Results
iGEM10_020b in pmllCA is perfect
iGEM10_042a in pmllAC's fwd read was messed up. I submitted the exact same part w/ ca998 again.
iGEM10_041b in pmllCA is perfect
Next Assembly step: Creating iGEM10_045/046 and 049/050 (Self-Lysis T ver)
Assemble iGEM10_042/041 with iGEM10_43/044
I have left over righty digest of iGEM10_043/044, so I only have to set up a Lefty digest of iGEM10_042/041. NOTE: iGEM10_042 hasn't been sequence confirmed yet, but I'm going to go ahead with assembly and keep my fingers crossed.
I think I started it around 2:00pm.
Started ligation at 4:37pm. Used 2114+2275/2316 digests from construction of 47 and 48.
Amy N. Kristofferson 14:07, 26 July 2010 (EDT)
To do:
- Transform cells w/ best igem20 map
- order oligos
- submit best igem20,41,42 map for sequencing
- start next assembly step for 41, 42?
Oligos
Designed the following oligo: igemTen048 gctagCTCGAGttaAACTTTACGTTTTTTTTTCGGCGG 38 rev xhoI 1858 {<NLS!}
ColPCR results
Expected length: about 900bp. They all look good. Mapping won't show me much, since the NLS is so small (~30bp). So I'm going to sumbit two samples for sequencing, using the g00101 oligo. If they're cotransformed, I'll get back a mixed read.
Expected lengths for iGEM10_042: 2895bp (lanes 1-4) and iGEM10_041: 3126bp (lanes 5-8)
Results: 42a,b,c and 41b,d look good. I'll map all the minipreps anyway.
Miniprep Mapping
They all look good! iGEM10_020 is a little faint, but I'm going to send off a sample of each to be sequenced.
I ran the same gel out for a few more minutes... You can see the sizes of the 42 and 41 digests better now...
| Lane | Part | Digest | Expected length |
| 1 | 42a | Eco/XhoI | 3768, 1672 |
| 2 | 42b | Eco/XhoI | |
| 3 | 41b | Eco/XhoI | 3998, 1672 |
| 4 | 41d | Eco/XhoI | |
| 5 | 20b | Eco/Bam | 6246 (part), 2745 (vector) |
| 6 | 20d | Eco/Bam | |
| 7 | 20e | Eco/Bam | |
| 8 | 20f | Eco/Bam | |
started at 12:00pm.
Transformed jtk030 with iGEM10_020b=
Started rescue at 2:25pm. Labeled "Sequenced MP of iGEM10_020b." I'll grow up colonies tomorrow so I can perform the Transposase Assay on Wednesday.
Sequencing submissions
Submitted iGEM10_020b in pmllCA, iGEM10_042a in pmllAC, iGEM10_041b in pmllCA, and jh1884+1858 in 1601CK A,B for sequencing.
Bam/XhoI digest started at 1:50pm.
Amy N. Kristofferson 14:07, 24 July 2010 (EDT)
To do:
- Run gel of colPCRs from Friday and Sat.
- Map Minipreps of 1884+1848.
- Miniprep any iGEM10_020's that aren't co-transformed.
- Miniprep the 41/42 samples w/ good colPCR results.
- figure out what to do w/ ef1a and atub
Colony picking: 42/41PCR+pMLL4AC and iGEM10_020
Picked 8 colonies of iGEM10_020 and checked for cotransformation. Didn't run a colPCR b/c the part is too big. Picked 4 colonies of 42/41PCR+pMLL4AC and started a 4K colPCR. Had to make more colPCR MM.
Miniprepped all 1884+1858 samples
Labelled 1884+1858a-h and placed in Amy #2. I need to map them.
Sequencing Results for iGEM10_019b
The part looks great! I'm glad I continued on with assembly.
| iGEM84 | iGEM10_019b | ca998 | Perfect partial. First 900bp look great | |
| iGEM85 | iGEM10_019b | g00101 | Perfect partial. Last 900bp look great |
Amy N. Kristofferson 13:45, 23 July 2010 (EDT)
To do:
- analytical gel of PCR of 42+41
- if it looks good, digest eco/bam and ligate w/ pMLL4AC.
- MP iGEM10_019b,d
- Map
- Submit for sequencing
- Start next stage of assembly
- Pick colonies from 1884, 1858. ColPCR, innoculate. No need to check for co-transf (same color)Tomorrow, miniprep and eco/bam into 9145. (xhoI site right after Bam)
- Pick lots of colonies from ef1a/atub+2093 plate.
- Redo-transformation of 47 and 48 (nothing grew on Tahoura's plates)
Later...
- Pick colonies of igem47,48. Rough test to see how long it takes bacteria to lyse in TB
Colony Picks
1884+1858: expected colPCR length: 912bp efla/atub+2093 expected colPCR lengths: 1952, 2190bp
Ran col3k pcr.
Assembly: iGEM10_020 and Eco/Bam 41 and 42 PCR products into pMLL4AC
Digests:
eco/bam: 41, 42
R: bgl/xhoI of igem019-gel purify (mapping at same time): 6181, 1607. Cut out top band.
L:bam/xhoI of igem001
digests started at 12:46pm
Gel purified 19b,d: There was a band at around 6000bp, but I couldn't see one at 1607, but that could be because I ran the gel for a long time. I gel purified the top band anyway and I'll continue on with the next step of assembly. I could map again, but I think my analytical colPCR combine with sequencing results will be a pretty good confirmation.
Zymo'd 41, 42, and 1.
Ligations:
41/42+pMLL4AC, transform into lefty 19b/d with 1, transform into jtk030
Started at 2:55pm.
Rescue started at 3:41pm.
PCR of ca998/g00101 off iGEM10_042 and 041 in hybrid vector
Analytical Mapping:
Lane 1: iGEM10_042, expected length: 2863bp
Lane 2: iGEM10_041, expected length: 3093bp
The PCRs look successful. I'm going to Eco/Bam the PCR product and ligate with pMLL4AC.
Cotransformation Results for iGEM10_019 and ef1a/atub+2093
iGEM10_019: only sample c was co-tranformed, but I'm only going to miniprep b and d, since I forgot to streak sample a on the antibiotics plate.
All of the samples for ef1a/atub+2093 were co-transformed. I'll pick a lot more colonies today, colPCR, inoculate, and streak for cotransformation.
Amy N. Kristofferson 14:37, 22 July 2010 (EDT)
To do:
- Plate at 4:35pm
- Run colony PCR on gel
- See if i have any ef1a MPs that mapped well that I could submit for sequencing. I want one w/o the double T deletion. However, it's prob before the atg used as a start codon, so it may not affect anything. We'll see...
- On a second glance, mapping data for ig114/2271+2017 could be ok. Maybe do with iGEM10_043/044 (four reactions total) and submit them for sequencing?
Nuclear Localization check
pjc012 backbone
Bgl/XhoI transfer of CDS of our protein
his6tag prom-rbs-his6-my gene!
rfp+nls: 1884+1858 in 1601KC
Transformed into jtk049. Started rescue at 3:35pm. Plated on KC.
Tomorrow, pick colonies. Can do colPCR off plasmid (1601 series).
Next day: miniprep, map, sequence? PCR on bgl/xhoI sites.
may need to pcr a new bam/xhoI around GFP-Nls and then cut into mike's plasmid
Sequencing Results for iGEM10_047, 48, 51, 52 (SL/VB Assembly Product with L-Lysozyme Self Lysis
All parts look perfect for about the first and last 1000bp.
| iGEM72 | iGEM10_048a in AK | ca998 | Perfect partial. Good for first 1000bp | |
| iGEM73 | iGEM10_048a in AK | g00101 | Perfect partial. Good for last ~1000bp | |
| iGEM74 | iGEM10_051a in AK | ca998 | Perfect partial. Good for ~900bp, \"mutations\" are conserved. | |
| iGEM75 | iGEM10_051a in AK | g00101 | Perfect partial. Good for last ~950bp.. | |
| iGEM76 | iGEM10_052a in AK | ca998 | Perfect partial. Good for first ~900bp | |
| iGEM77 | iGEM10_052a in AK | g00101 | Perfect partial. Good for last ~950bp.. |
Picking ef1a/atub-Bjh2093 in pMLL/1601KC hybrid vector colonies
- Pick four colonies of each.
- ColPCR w/ ca998/g00101
- Inoculate in LB-KC
Picking iGEM10_019 colonies
The plate looks great. It's covered in fairly healthy looking colonies.
- Pick 4 colonies off of iGEM10_019 plate.
- Run ColPCR w/ conor's oligos from Gibson:
| igemTen021 | gtcgactgtctcttatacacatctcaaccgGATCTCTGGCAGTTCCCTAC | 50 | \"fwd for iGEM10_017 + iGEM10_016 |
| Gibson fusion\" | |||
| igemTen024 | cGTCGACTGTCTCTTATACACATC | 24 | rev for iGEM10_016 Gibson fusion |
If both 17 and 16 (a part of 18) are there, the colPCR will produce a band ~888bp long.
- Inoculate in LB-AK
ColPCR results from above colony picks
Lane 1-4: iGEM10_019 w/ igemTen21/24, I wanted 888bp band, so they all look great!
Lane 5-8: ef1a+2093 w/ ca998/g00101, expected 1952, all bad--last two are probably cotransformed w/ ef1a parent vector
Lane 9-12: atub+2093 w/ ca998/g00101, expected 2190, all bad
Even though my ef1a/atub+2-93 colPCR results don't look so hot, I'll miniprep the ones that weren't co-transformed and map them tomorrow.
ColPCR results for ig114/2271+2017 picks
This analytical backbone PCR seems useless, since a 900bp band was supposed to reveal the presence of the p15 origin of rep, a sign that the part was in the hybrid vector but my negative control, a part in pMLL4AC, also produced a 900bp band! My only choice of analysis then is mapping, but all of the colony PCRs look very crazy. Maybe I'll just miniprep and map them all anyway. Another route I could do would be to perform an Eco/Bam transfer into a vector w/ diff antibiotics, and then do another Eco/Bam transfer into the PMLL4AC. That's just going take a long time...
th395/th396
| Lane | Part | Don\'t want |
| 1--4 | 2271+2017 | ~900bp band |
| 4--8 | ig114+2017 | |
| 9 | 2345 In pMLL4AC | |
ca998/g00101
| ' | ' | ' |
| Lane | Part | Expected length |
| 1--4 | 2271+2017 | 2895 |
| 4--8 | ig114+2017 | 3126 |
Minipreped everything and started an analytical Eco/XhoI digest at 5:21pm.
| iGEM name | Digest | Expected length | Expected length if still in hybrid |
| iGEM10_042 | Eco/XhoI | 3768, 1672 | 4702, 1672 |
| iGEM10_041 | Eco/XhoI | 3998, 1672 | 4932, 1672 |
One of these is clearly still in its hybrid vector, but I don't know what's going on with the single bands. I'm going to Fusion PCR off ___ using ca998 and g00101. Then I'll Eco/Bam that into PMLL4AC.
Amy N. Kristofferson 13:04, 21 July 2010 (EDT)
ig114/2271+2017 vector transfer redo
Pick 4 colonies for ig114/2271+2017. Normal colPCR seems to be a waste of time, but I'll try it anyway. I'm also going to do my backbone analysis PCR. Negative control: Bjh2345 in PMLLAC.
Assembly of iGEM10_018 and 017 to make iGEM10_019
Manual R/L Digest of iGEM10_018 and 017. Started at 10:00am. Zymo'd. Ligation started at 1:08pm. Transform into Righty cells. Rescue started at 1:50pm Plated on KA. Labelled plate iGEM10_019.
One Pot Assembly of atub/ef1a with jh2093
DNA used: Rigthy: Bjh2093 in 1601AC Lefty: ef1a PMLLKA b (7/14 miniprep) and atub PMLLKA b (7/14 miniprep) All samples are methylated.
NOTE: I'm intentionally creating a hybrid vector! I think this will save time. Just make sure not to transform into Righty, because then I won't be able to Eco/Bam the product into a good vector. Also, this ef1a has a two base pair deletion, so it may not be functional.
Digest started at 1:32pm. Heat kill at 2:49pm. Add ligase at 3:15pm. Add jtk030 cells and heat shock at 3:45pm. Start rescue. Plate at 4:49pm.
- Set up the digestion:
1uL lefty plasmid(methylated) 1uL righty plasmid (methylated) 1uL NEB2+ATP 0.3 uL XhoI 0.3 uL BglII 0.3 uL BamHI 6.1uL Water
- Digest for 1 hour at 37C
- Heat kill at 65 for 20 min
- Add 0.3uL T4 Ligase
- Ligate at room temperature for 30 minutes
- Put on ice for transformation
- Transform, rescue, plate on dual antibiotic plates
Amy N. Kristofferson 13:45, 20 July 2010 (EDT)
None of the colonies picked yesterday from the iGEM10_047, 48, 51, 52, or 16+2294 were co-transformed. And since the ColPCR didn't reveal much of anything, I'm just going to miniprep the first two samples of each, except for iGEM10_047. iGEM10_047's d sample looked great on ColPCR, so I'll miniprep sample a and d instead of a and b. Also, somehow all 12 of the colonies that I picked for the transfer of 2271/ig114+ 2017 from the hybrid into PMLL4AC seemed to still be in the hybrid vector, based on my analytical pcr (they all had bands around 900bp). I'll miniprep four of each anyway and map them. If they're not the right side, I'll do the transfer over again.
To do:
- Minipreps
- Ask Tim about Ef1a sequence.
Picking colonies w/ Payload and Payload delivery
30µL into ea mL TB media (use TB for growing up for assay)
Miniprep Map
| Tube | Mapping | iGEM name | Digest | Expected length | Expected length if still in hybrid | Good? |
| 1,2 | 2271+2017 w/ PMLL4AC | iGEM10_042 | Eco/XhoI | 3768, 1672 | 4702, 1672 | Possibly. Upper band looks good. Perhaps lower band too faint |
| 3,4 | ig114+2017 g.p. a w/ PMLL4AC | iGEM10_041 | Eco/XhoI | 3998, 1672 | 4932, 1672 | Possibly. Upper band looks good. Perhaps lower band too faint |
| 5,6 | 2345 in PMLL4 b w/ 2114+2316 g.p. a | iGEM10_047 | Eco/Bam | 5533, 2877 | a,b | |
| 7,8 | 2345 in PMLL4 b w/ 2114+2275 a (7/14) | iGEM10_048 | Eco/Bam | 6102, 2877 | a,b* | |
| 9,10 | 1968 in PMLL4 b w/ 2114+2316 g.p. a | iGEM10_051 | Eco/Bam | 5763, 2877 | a,b | |
| 11,12 | 1968 in PMLL4 b w/ 2114+2275 a (7/14) | iGEM10_052 | Eco/Bam | 6332, 2877 | a.b | |
| 13,14 | 16a w/ 2294 | Eco/Bam | 3166, 2745 | righty methylated!! | good for one cut, but need to do Eco/XhoI | |
Submitted a sample a for each of the 2345/1968 assemblies for sequencing, except I submitted sample d for iGEM10_047.
16+2294 is righty methylated. That's why I only got one band. It's the right sized band though. I'll map it with Eco/XhoI. Started digest at 4:10pm.
Lane 1: 16+SLa
Lane 2: 16+SLb
Expected lengths: 4644, 1466
Analysis: I think the top band is parent vector. Don't know why sample B has three bands... very strange. I submitted a for sequencing.
Redo of Hybrid vector transfer
Those oligos shouldn't PCR off the genome (http://archaea.ucsc.edu/cgi-bin/hgPcr?hgsid=462798&org=Escherichia+coli+K12&db=eschColi_K12&wp_target=genome&wp_f=cggttatccacagaatcaggg+&wp_r=gcgctgatgtccggcggtgc&Submit=submit&wp_size=8000&wp_perfect=15&wp_good=15&boolshad.wp_flipReverse=0)
I'm going to make more of pMLL4AC Eco/Bam digest from Tim's stock in plate 2, well F7 (pMLL4AC Bth8062). Started digestion at 2:04pm. Drop out is 813bp. Vector should be 2745bp.
Use 3uL of digested pMLL4AC instead of 1uL when ligating.
Unfortunately, there's only about 1.75uL of digest PMLL4AC vector left, so I used it to redo the ligation w/ eco/bam digested ig114+2017. I started the ligation at 1:51pm. Started rescue at 3:04pm.
Redo of ligation with new pre-digested and gel purified PMLL4-AC w/ FFGFP dropout. Started ligation at 4:45pm. Started rescue at 5:30pm.
Amy N. Kristofferson 14:51, 19 July 2010 (EDT)
Everything grew up very well. The only concern I have is that the colonies with 2345 in the part have a transparent loop around the colony, possibly suggesting that self-lysis is starting. I'll have to careful when I miniprep these.
I pick colonies, ran a normal colony pcr for all of them, ran an analytical pcr to make sure the parts I transfered out of the hybrid vector aren't still in the hybrid vector, inoculated and check for co-transformation for the assembly plates. Here are my notes:
- pick four colonies off each plate.
- run colPCRs w/ ca998/g00101 for all of them
- run colPCRs w/ th395/th396 on ig114+2017 and 2271+2017 vector transfers and original minipreps to check for hybrid
Timing wise:
- make colPCR MM for 5 rxns w/ th395/396.
- set up tubes for colPCR (need 28 tubes for regular, and 8+2=10 for th395/396 version)
- set up plate for co-transformation check: 5x4 grid
- cross out gfp colonies on ig114/2271+2017 plates
- set up two 24-well plates. Need 2AC-4AK-1AC LB.
- pick colonies, colPCR (don't forget to double dip for the 2017s!), inoculate, co-transf. plate
- don't forget to add template DNA from original minipreps for th395/6 PCR for comparison check.
Analytical PCR results for Transfer from hybrid vector
This is a gel from a colPCR with oligos th395/th396 of four colonies picked from 2271+2017 and ig114 7/16/10 plates. If the plasmid is still a hybrid, it will contain the p15 origin of replication, and will PCR off a ~900bp DNA. This gel suggests that all the colonies I picked contained the hybrid vector. Tim said that if I need to do the transfer over again, I should use more pMLL vector (~3uL). For now, I'll pick more colonies.
| Tube | Part |
| 1a-4a | iGEM10_042 |
| 5a-8a | iGEM10_041 |
| 9a | 2271+2017 in hybrid vector |
| 10a | ig114+2017 g.p. in hybrid vector |
ColPCR
This results aren't very good. But I think that's to be expected when parts are about 6k or greater. I'm going to mostly ignore these results and miniprep a couple samples from each reaction anyway.
The analytical PCR makes it seem like all the hybrid transfers are still in the hybrid vector... :(
| ColPCR tube | DNA | iGEM name | oligos | Expected length | Good? |
| 1--4 | 2271+2017 w/ PMLL4AC | iGEM10_042 | ca998/g00101 | 2895 | |
| 5--8 | ig114+2017 g.p. a w/ PMLL4AC | iGEM10_041 | ca998/g00101 | 3126 | |
| 9--12 | 2345 in PMLL4 b w/ 2114+2316 g.p. a | iGEM10_047 | ca998/g00101 | 5733 | d |
| 13--16 | 2345 in PMLL4 b w/ 2114+2275 a (7/14) | iGEM10_048 | ca998/g00101 | 6302 | |
| 17--20 | 1968 in PMLL4 b w/ 2114+2316 g.p. a | iGEM10_051 | ca998/g00101 | 5963 | |
| 21--24 | 1968 in PMLL4 b w/ 2114+2275 a (7/14) | iGEM10_052 | ca998/g00101 | 6532 | |
| 25--28 | 16a w/ 2294 | ca998/g00101 | 3366 | ||
| 29--36 | 2271+2017 w/ PMLL4AC | th395/396 | |||
| Small gel: 1--8 | ig114+2017 g.p. a w/ PMLL4AC | th395/396 | |||
Amy N. Kristofferson 15:20, 16 July 2010 (EDT)
To do:
-Eco/Bam digest ig114+2017 g.p. and 2271+2017 g.p. Run on gel and gel purify. Ligate to pMLLAC pre-digested vector. (calculated expected lengths before running gel, to make sure it's worth the trouble. Bands might be so similar that maybe just a zymo is better)
-ligate g.p. 2294 with g.p. 16a.
-assemble SL-L with vacuole buster:
- Bjh2345 in pMLL4-AC with iGEM10_043 and iGEM10_044 (I'm going to use my 2114+2275 miniprep from 7/13, even though it hasn't been sequenced yet. It mapped well, but this doesn't say much since Pcon is so small. Even so, I'm do the reaction anyway and trash it if the sequence comes back bad, like the last one did.)
- Bjh1968 in pMLL4-AC with iGEM10_043 and iGEM10_044
NOTE: can't use one pot because iGEM10_043 and iGEM10_044 are NOT methylated. I transformed jtk030 cells to make them. I'll have to do separate righty and lefty digests.
Sequence Analysis of Ef1a/Atub
| iGEM57-ef1a | ef1a animal promoter (iGEM10_021 in PMLLKA) miniprepped 7/14 | ca998 | Deletion of two T\'s at around 410bp. Would cause a frame shift, so it\'s useless. | |
| iGEM58 | atub animal promoter (jh2342 in pMLLKA) miniprepped 7/14 | ca998 | Perfect partial. The read was very short. Only the first 200bp or so were good. |
So where to go from here?
I'll submit atub for sequencing with g00101. As for ef1a, since my ef1a in the AK vector (was supposed to be KA... argh) sequenced perfectly. I'll just Eco/Bam Transfer it? Then I'll get colonies tomorrow, and I can ColPCR/inoculate and then miniprep on Tuesday. OR I could pick more colonies today. However, even if I map well, the part could have mutations...
Transfer of 2271/ig114+2017 to PMLLAC from pMLL/1601 hybrid
Eco/Bam digest of 2271+2017 g.p. a, ig114+2017 g.p. a.
Gel purify part:
2271+2017 in pMLL/1601 vector Eco/Bam: 3670, 2704 Lower band includes parts.
ig114+2017 in pMLL/1601 vector Eco/Bam: 3670, 2934 Lower band includes parts
When I pick colonies, I'll run two ColPCRs: ca998/g00101 and th395/th396. If the plasmid is still a hybrid, it will contain the p15 origin of replication, and will PCR off a ~900bp DNA. I'll also run the ColPCR on colonies that I know contain the hybrid so that I can compare. This will allow me to do less minipreps. I'll still map them though, to confirm the vector size.
TH395 gcataGAATTCcggttatccacagaatcaggg fwd for EcoBAM p15A, pBth7011 TH396 ctaggGGATCCgcaccgccggacatcagcgc rev for EcoBam p15A, pBth7011
Second Step of Assembly for SL/VB: L-1968/2345 to iGEM10_043/044
Bam/XhoI: 2345 in PMLL4 b, 1968 in PMLL4AC (T1, L) Bgl/XhoI: 2114+2316 g.p. a, 2114+2275 a (7/14)
Transposase Assay: ligating gel purified 16a to gel purified 2294 in CORRECT KA vector
Details of today's Digestions, Ligations, Transformations, and Platings
| Tube | DNA | Enzymes |
| 1 | 2271+2017 g.p. a | Eco/Bam |
| 2 | ig114+2017 g.p. a | Eco/Bam |
| 3 | 2345 in PMLL4 b | L: Bam/XhoI |
| 4 | 1968 in PMLL4AC (T1, L) | L: Bam/XhoI |
| 5 | 2114+2316 g.p. a | R: Bgl/XhoI |
| 6 | 2114+2275 a (7/14) | R: Bgl/XhoI |
| Tube | DNA | Transform into | Plate on |
| 1 | 2271+2017 w/ PMLL4AC | Lefty | AC |
| 2 | ig114+2017 g.p. a w/ PMLL4AC | Lefty | AC |
| 3 | 2345 in PMLL4 b w/ 2114+2316 g.p. a | jtk030 | AK |
| 4 | 2345 in PMLL4 b w/ 2114+2275 a (7/14) | jtk030 | AK |
| 5 | 1968 in PMLL4 b w/ 2114+2316 g.p. a | jtk030 | AK |
| 6 | 1968 in PMLL4 b w/ 2114+2275 a (7/14) | jtk030 | AK |
| 7 | 16a w/ 2294 | Righty | CA |
Submit 2114+2275a 7/13 miniprep for sequencing
Submissions:
| iGEM60 | 2114+2316a 7/13 miniprep fwd | ca998 | |
| iGEM61 | 2114+2316a 7/13 miniprep rev | g00101 |
Results: Great! This part is as it should be.
Sequencing Results for ig114+2017
| iGEM59 | ig114+2017 g.p. | ca56 | Perfect partial: shows the correct junction between Pbad and SL-T. These three reads don\'t all overlap, but I think it\'s safe to assume the part is Perfect. |
I'm going to Eco/Bam Transfer the part, because it's currently in a pMLL-jh1601 fusion backbone.
Amy N. Kristofferson 14:55, 15 July 2010 (EDT)
To do:
- reinterpret mapping results w/ SL with 1601 plasmid
- Design oligo for sequencing of 2271+2017
- gel purify SL. Ligate to gp'd 16a
- sequence analysis of ef1a and atub
Important Mini-meeting update: Issue with SL Assembly probably resulted from use of 2017 in 1601 vector
Mapping Yesterday's Minipreps
Ran out the gel a bit more, and I think it shows that the two 2271+2017 samples mapped well:
| Lane | Miniprep | Digest | Expected Lengths | ' | Cut out | Good? |
| 1 | 2114+2275a | Eco/XhoI | 4627, 1466 | good | ||
| 2 | 2114+2275b | Eco/XhoI | 4627, 1466 | good | ||
| 3 | 2271+2017a | Eco/XhoI | 3768, 1672 | too big | ||
| 4 | 2271+2017b | Eco/XhoI | 3768, 1672 | too big | ||
| 5 | ig114+2017e | Eco/XhoI | 3998, 1672 | too big | ||
| 6 | ig114+2017f | Eco/XhoI | 3998, 1672 | too big | ||
| 7 | ef1a in PMLLKA b | Eco/Bam | 2868, 897 | good | ||
| 8 | atub in PMLLKA b | Eco/XhoI | 2405, 1598 | good | ||
| 9 | atub in PMLLKA c | Eco/XhoI | 2405, 1599 | bad | ||
| 10 | jh2294 in PMLLKA | BglII/XhoI | 3777, 1607 | Upper band | good | |
Sequencing Results for the rest of the Minipreps from my first batch of colony picks from Gel-Purified Assembly
| Submission Name | Part | Oligo | Analysis |
| iGEM51 | 2114+2275 g.p. F | ca998 | BAD- a bunch of junk. No alignment with sequence. |
| iGEM52 | 2114+2275 g.p. R | g00101 | Perfect partial. The last 1000bp or so of the part is perfect |
| iGEM53 | 2271+2017 g.p. F | ca998 | Perfect Partial- first ~1000bps of the part is right |
| iGEM54 | 2271+2017 g.p. R | g00101 | Perfect Partial- last ~700bp of part look good |
| iGEM55 | ig114+2017 g.p. F | ca998 | About 1000bp aligned, except for mutation: @ 291bp, mutation: @ 449bp |
| iGEM56 | ig114+2017 g.p. R | g00101 | Perfect Partial: last 700bp sequenced perfectly |
The boundaries of parts 2114+2275 and ig114+2017 look good. I'm going to PCR off the middle to check if the insides are go too. I used ca56 for ig114+2017 (binds to pbad promoter). I designed a primer for the middle of
Amy N. Kristofferson 13:24, 14 July 2010 (EDT)
To do:
- Redo cotransformation of Tera'a Payloads with Payload delivery devices in 1601K. DON'T FORGET MG!!!
- Run colony PCRs for KA transfer
- Run colony PCRs for SL/VB Assembly colony picks
- Miniprep everything that wasn't co-transformed
Sequencing Submissions: the rest of my gel-purified assembly minipreps
iGEM51-56= each part w/ ca998 and g00101
Cotransformation Redo
Rescue started at 11;32am.
Sequencing Results for 2114+2316 (iGEM10_043): Great news! Successfully put Pcon in front of VBa
I submitted the part with ca998 and g00101, and the results clearly show that the Pcon is in front of the vacuole buster. Woo hoo!
KA transfer
Christoph Miniprepped everything he needed.
I miniprepped the remaining 1mL of 10 or bjh2294-PMLLKA (eluted with 25uL to keep normal MP concentration), ef1a-PMLLKA b, atub-PMLLKA b,c.
Parent Vector bleed-through results: All samples from 1,2,3,4,6,7,8,12,13,16 are good. The only samples with co-transformation were 15a and 9a,b,d.
Colony PCR- ca998+g00101
| Tube | Lane | Quick Ref | part | expected length | good? |
| 1--4 | 1,3,5,7 | 1 | sbb09 | 235 | all good |
| 4--8 | 9,11,13,15 | 2 | sbb07 | 1631 | a,b,d |
| 9--12 | 2,4,6,8 | 3 | sbb06 | 441 | all good |
| 13--16 | 10,12,14,16 | 4 | sbb04 | 1988 | all good |
| 17--20 | 17,19,21,23 | 6 | sbb19 | 797 | all good |
| 21--24 | 25,27,29,31 | 7 | sbb12 | 434 | all good |
| 25--28 | 18,20,22,24 | 8 | sbb10 | 1226 | all good |
| 29--32 | 26,28,30,32 | 9 | sbb42 | 291 | all good |
| 33--36 | 33,35,37,39 | 10 | Bjh2294 | 2707 | a,d |
| 37-40 | 41,43,45,47 | 12 | sbb04 | 1988 | a,c |
| 41-44 | 34,36,38,40 | 13 | sbb19 | 797 | a,d |
| 45-48 | 42,44,46,48 | 15 | sbb10 | 1226 | all good |
| 49-52 | 49,51,53,55 | 16 | sbb42 | 291 | a,b,c |
| 53-68 | 57,59,61,63,50,52,54,56,58,60,62,64 (52,54,56-64) | 5 | Bjh1906 | 247 | all good, except h |
| 69-76 | 65,67,69,71, 73,75,77,79, 66, 68, 70,72 (65-73, 75,77,79) | 11 | Bjh2245 | 297 | all good, except a, j |
| 77-80 | 74,76,78,80 | ef1a | 1088 | b | |
| 81-84 | 81,83,85,87 | atub | 1326 | b,c,d | |
NOTE: lanes 49-96 refer to the middle gel. Just subtract 48 from the lanes in the table to see what number to refer to on the actual gel.
Colony PCR-th313+iGEM10
Note: the results for 5 are in the middle right gel shown above.
| Tube | Lane | Quick Ref | Part | Expected length | Good? |
| 1--12 | 89,91,93,95 and 82-96 even | 5 | Bjh1906 | about 1650 | all good, excect h |
| 13-24 | small gel: 1-12 | 11 | Bjh2245 | about 1651 | b,c,e |
SL/VB Assembly Colony Picks
Cotransformation results: 2h and 6a were co-transformed. Everything else had no growth on the triple antibiotics plate.
| Column | Part | Plate Date | Lane | Expected lengths for ColPCR | Good lanes | Good wells | Miniprep |
| 1 | 2114+2275 | 8-Jul | 1-15odd | 3622 | possibly 11,13,15 | a,b,c (I accidentally added the samples in the inverse order to the gel) | a,b |
| 2 | 2114+2275 | 7-Jul | 2-16even | 3622 | |||
| 3 | 2271+2017 | 8-Jul | 17-31 odd | 2895 | possibly 17, 19 | a,b | a,b |
| 4 | 2271+2017 | 6-Jul | 18-32even | 2895 | |||
| 5 | ig114+2017 | 8-Jul | 33-47 odd | 3125 | 43 | f | e,f |
| 6 | ig114+2017 | 6-Jul | 34-48even | 3125 | |||
Amy N. Kristofferson 18:16, 13 July 2010 (EDT)
Co-transform jh2348/2291-1601K with Tera's Payload
Added 100uL of H2O to 1uL of DNA from Tera's Ef1a and Atub payload constructs.
Added 10uL of H2O to 1uL of DNA from my minipreps of 2348/2291-1601K.
Added 1uL of each of those dilutions to 70uL of MG1655 cells.
Mg needs to be added for all steps of cloning the PDD's 1M MgSO4 10µL into rescue step (after heatshock) 400µL spread on plate (if +Spec, add 20µL and spread) 30µL into ea mL TB media (use TB for growing up for assay)
Started rescue at 4:06pm.
KA Vector transfer: ColPCR (parts and vector backbone check), inoculate, grow up
I picked colonies, inoculated and ran a colony pcr for all the parts we moved into the new, CORRECT KA vector.
Important notes:
- 5 and 11 were originally in AK vectors. 10 was also in an AK vector, but I gel purified it. Even so, I will run an analytical PCR of my minipreps of 10, and I ran an analytical Colony PCR with th313 and g00101 for my 5 and 11 colonies. I picked 12 colonies of 5 and 11.
- I also check for parent vector bleed-through by plating all the parts on spec, except for 9 (plated on triple antibiotics since it came from CK) and efla+atub (PCR products)
- All the inoculations are in the shaker.
- The colony PCRs are in the black PCR machines. They'll probably be done around 6pm.
SL/VB Assembly: Picking colonies from 7/6, 7/7, and 7/8 plates
Picked 8 colonies from Assembly attempt #2 (one pot) and assembly attempt #3 (gel purification) for 2114+2275, ig114+2017 and 2271+2017. Inoculated, checked for co-transformation, and set up ColPCR.
Amy N. Kristofferson 14:43, 12 July 2010 (EDT)
IMPORTANT UPDATE: TUBE MARKED PMLL6 (KA) in Eco/Bam Box is INCORRECT
Christoph just ran and analytical digest/gel that proved that the vector in the tube that was supposed to contain KA actually contained AK vector instead of KA. I need to Eco/Bam transfer the parts into a new KA vector. Also, this explains why the assembly with the Self-Lysis Device didn't work. We need to Eco/Bam transfer it into a KA vector too.
Digesting the new pMLL-KA backbone
Marianna gave us 10uL of her CMED7 in KA part. The dropout will be 324bp. To digest all of it, I multiplied the Analytical Mapping protocol by 2.5:
10uL of Water 10uL of CMED7-PMLLKA Miniprep 2.5uL NEB 1.25uL EcoRI 1.25uL of BamHI Total: 25uL Load 12.5uL into 2 wells. Gel Purify. Elute each with 12.5uL of H20.
Started digest at 4:30pm.
Ligation of ef1a and atub (bjh2342) eco/bam zymo'd digest
Ligated ef1a and atub eco/bam zymo'd digests (from my previous insertion into the supposed KA vector) with the new gel purified Eco/Bam digested KA vector. Started at 7:05pm. Transformed jtk030, MC1061 pir+ cells. In retrospect, I could have used Lefty.
Checking vector backbones of SL/VB Eco/Bam transfers
Set up a 2K55 PCR reaction with Taq MM, 1uL of 1/10 th313 oligo (in the middle of AmpR) and iGEM10 (rev oligo right before EcoR1 site) to verify the order on antibiotics on the backbone. This reaction PCR's off the AmpR gene to right before the EcoRI site. So if the vector is actually A-, the PCR product will contain a bit of AmpR and plasmid backbone and will be 865bp. If the plasmid is -A, the PCR product will contain a bit of AmpR, lots of plasmid backbone and the other antibiotic. In the case of CA, this amounts to 1808bp.
See Eco/Bam page in Excel notebook.
This data suggest that all the backbones that should be A- are indeed A- and that all the backbones that are -A are indeed -A. So the antibiotics shouldn't be the problem. For whatever reason, nothing turned up in the 2345 lane. I'll run the PCR again just to double check.
| Lane | Part | Color | Expected length | Good? |
| 1 | Bjh2345 | AC | 865 | no-empty lane |
| 2 | Bjh2271 | AK | 865 | yes |
| 3 | Bjh1968 | AC | 865 | yes |
| 4 | Bjh2316 | AK | 865 | yes |
| 5 | Bjh2275 | AK | 865 | yes |
| 6 | Bjh2114 | CA | 1808 | yes |
| 7 | ig114 | AK | 865 | yes |
Lane Part Color Expected length Good? 1 Bjh2345a AC 865 no-empty lane 2 Bjh2345b AC 865 good 3 Bjh2345c AC 865 good
Threw out Bjh2345a. Must be a bad miniprep. I should probably map b and c. I guess I haven't yet...
Analytical digests of SL/VB Gel Purf. Assembly Minipreps
| Tube | Part | Digest | Color | Expected Lengths (part, plasmid) | Good? | Second Digest | Expected lengths | Good? |
| 1 | 2114+2316a | Eco/Xho | CK | 4058, 1466 | yes | started at 3:45 | ||
| 2 | 2114+2316c | Eco/Xho | CK | 4058, 1467 | yes | |||
| 3 | 2114+2275 | Eco/Xho | CK | 4627, 1466 | Eco/Bam (lane 1) | ? | ? | |
| 4 | 2271+2017 | Eco/Xho | AC | 3768, 1672 | Eco/Bam (lane 2) | ? | ? | |
| 5 | ig114+2017 | Eco/Xho | AC | 3998, 1672 | Eco/Bam (lane 3) | ? | ? | |
| 6 | iGEM16a+2294 | Eco/Xho | CA | 4644, 1466 | ||||
Payload Delivery: Analytical Mapping of 2348 and 2291 in 1601K
Both parts look great! I'm going to give them to Jin.
| Tube/Lane | part | Digest | Expected length | Good? |
| 1 | 1601K-jh2348 | Eco/Bam | 4632, 2475 | yes |
| 2 | 1601K-jh2291 | Eco/Bam | 5927, 2475 | yes |
Eco/Bam Transfer from Bad KA to Good KA backbone
| Lane | Part | short description | expected lengths | cut out |
| 1 | 1601K-jh2348 | payload | 4632, 2475 | |
| 2 | 1601K-jh2291 | payload | 5927, 2475 | |
| 3 | bjh2294 | conor\'s self lysis | 2868, 2516 | lower |
| 4 | bjh1906 | eco/bam plate: B11 | 46, vector (~2.8k) | zymo\'d (too small to purify) |
Amy N. Kristofferson 21:13, 10 July 2010 (EDT)
Must do today:
- Miniprep good colony pcr/cotransformations from yesterday
- Pick colonies for Tahoura
If I have downtime, could start items in the above To Do list
From yesterday's colony picks, only the first colony picked from 16a H3 was cotransformed. No idea how that happened, since I gel purified the digests before ligating.
Amy N. Kristofferson 13:37, 9 July 2010 (EDT)
Colony PCR of SL/VB and 16a+SL Assembly
Results:
Very odd. Even though I gel purified the correct bands, it appears that only 2114+2316 worked correctly. I'm going to check to make sure that everything is in the correct vector, because I don't know what else could be causing a problem. Since I'm miniprepping a the couple correct products, might as well miniprep and map a few others to try and figure out what the problem may be.
| Colony PCR | ' | ' | ' | ' | ' |
| Tube | Combo | Expected length | Good? | Cotransformed? | Miniprepped |
| 1 | 2114+2316 | 3053 | yes | yes | |
| 2 | \" | ||||
| 3 | \" | yes | yes | ||
| 4 | \" | ||||
| 5 | 2114+2275 | 3622 | yes | ||
| 6 | \" | ||||
| 7 | \" | ||||
| 8 | \" | ||||
| 9 | 2271+2017 | 2895 | yes | ||
| 10 | \" | ||||
| 11 | \" | ||||
| 12 | \" | ||||
| 13 | ig114+2017 | 3125 | yes | ||
| 14 | \" | ||||
| 15 | \" | ||||
| 16 | \" | ||||
| 17 | 16a+H3 | 3566 | yes | ||
| 18 | \" | yes | |||
| 19 | \" | ||||
| 20 | 16a+F3 | 3566 | |||
| 21 | |||||
Animal Promoter: Analytical Mapping of atub and ef1a promoter in pMLLKA
Started an Eco/Bam digest of the 4 minipreps I made of each promoter (all of which had GREAT colony PCRs) at 10:35am. They will be ready to run on a gel at 11:05am.
Once it has been verified that these parts map well, I'll submit them for sequencing and then begin the next step of assembly.
| Lane | Part | Digest | Expected Lengths | ' |
| 1 | iGEM10_021 in PMLLKA | Eco/Bam | 2868, 897 | all good |
| 2 | Bjh2342 in PMLLKA | Eco/XhoI | 2868, 1125 | all good |
Submitted ef1a-a and atub-b
Sequencing submission:
| iGEM35 | ef1a animal promoter (iGEM10_021 in PMLLKA) |
| iGEM36 | atub animal promoter (jh2342 in pMLLKA) |
Amy N. Kristofferson 14:36, 8 July 2010 (EDT)
Cotransformation check
None of the 2271+2017 or ig114+2017 colonies were cotransformed, but ALL of the iGEM10_018 (16a+SL) were cotransformed.
Colony PCR results for 2271+2017, ig114+2017 atub and ef1a promoter, iGEM10_16a
Can disregard the results for 16a+SL since all samples were cotransformed. 2017 combo inoculations are useless since nothing showed up on the colony pcr. Very strange, since they weren't co-transformed. GOOD NEWS: atub and ef1a look great.
| Tube | Part | Lane | Expected length | Good |
| 1--8 | 2271+2017 | 1-15odd | 2895 | |
| 9--16 | ig114+2017 | 2-16even | 2925 | |
| 17--24 | atub | 17-31 odd | 1326 | 19, 25, 29, 31 |
| 1a-8a | ef1a | 18-32even | 1088 | all good |
| 9a-24a | 16a+SL | 31-39 | 3566 | tube 16a looks good (40th well, 8th sample), but they\'re all cotransformed. |
Redo of SL/VB and 16a+SL digests with Gel Purification
To avoid co-tranformation and hopefully encourage the creation of the parts I want, I'm going to run a preparative gel, select the appropriate bands and gel purify.
Performed a Lefty (Bam/XhoI digest), Righty (Bgl/XhoI digest), and one-pot digest on all the parts in my SL/VB promoter as well as iGEM10_016a and Bjh2294 in PMLL-KA can be found in the Cheshire Chat plate in H3 and F3. I'll gel purify the Lefty digests of Bjh2345, Bjh2271, Bjh1968, Bjh2114, ig114, 16a and the Righty digests of Bjh2316, Bjh2275, and the two self-lysis devices. The other digests are just to make sure everything was methylated correctly and that the one-pot reaction works on these vectors.
Notes on protocols: Used Manual 2ab Assembly protocols for Lefty and Righty Mastermixes. Used my One-pot recipe, except with 0.4uL of each enzyme. Also, the DNA taken from the Cheshire Cat Plate was diluted by half b/c it was eluted with 100uL, so we had to adjust the amounts of NEB2 and enzyme used so that the recipe in the R/L digests turned out to be 1.6uL NEB2 and 1.5uL of each enzyme total, since our using 8uL of DNA instead of 4uL of DNA would otherwise have diluted the buffer and enzyme.
Digests started at 3:35pm.
From left to right: Lefty Digests, Righty Digests
Triple Digests
Results:
| Lane | Part | vector | Purify | L Fragments (if no methylation for R\'s) | R Fragments (if no methylation, for L\'s) | One Pot fragments (if not methylated) | Proper methylation? |
| 1 | ig114a | pMLL7-AK | L-Upper | 2925, 1196 | 2440, 1681 | 1681, 1244, 1196 | Yes |
| 2 | Bjh2114 | pMLL9-CA | L-Upper | 1518, 1270 | 1476, 1312 | 1476, 1270, 42 | Yes |
| 3 | Bjh2271 | pMLL7-AK | L-Upper | 2695, 1196 | 2210, 1681 | 1681, 1196, 3891 | Yes |
| 4 | iGEM10_016a | pMLL5-CK | L-Upper | 2333, 1196 | 2054, 1475 | N/A (not methylated) | |
| 5 | Bjh2316a | pMLL7-AK | R-Upper | 4491, 1196 | 4006, 1681 | 2810, 1681, 1196 | Yes |
| 6 | Bjh2275a | pMLL7-AK | R-Upper | 5060, 1196 | 4575, 1681 | 3379, 1681, 1196 | Yes |
| 7 | Bjh2294 F3 | pMLL9-CA | R-Upper | 4114, 1270 | 3777, 1607 | 2507, 1607, 1270 | Yes |
| 8 | Bjh2294 H3 | pMLL9-CA | R-Upper | 4114, 1271 | 3777, 1608 | 2507, 1607, 1271 | Yes |
NOTE: lane 2 in the lefty gel is Bjh2294 H3, and everything else is pushed over one lane
Summary: Everything is methylated as it should be. I cut out all the right bands and purified them. Also, this shows that triple digestion isn't very efficient and cause a lot of parent vector bleedthrough (the top band of all the lanes). Also, note how dilute the SL DNA is... I'll still elute with the standard 8.5uL to concentrate the DNA, but this is still a potential problem.
Ligation and Transformation of SL/VB and 16a+SL purified digests
Started ligation at 6:45pm. Will transform into jtk030 (pir +, MC1061 cells). I forgot to digest 2017, so I used a righty digest that I had done previously. Started rescue at 8:10pm.
Amy N. Kristofferson 13:45, 7 July 2010 (EDT)
All the samples from 16a,b + SL were cotransformed, and since Jin mentioned that making a mastermix for the onepot reaction may result in there not being enough enzyme per reaction, I'm going to do it over again without making a mastermix AND using 0.5uL of enzyme instead of o.3uL of enzyme. This should cut back on parent vector bleedthrough as well.
There are a significant number of colonies on the plate for the 2271+2017 and ig114+2017 redo. I'll pick colonies/colony pcr/inoculate/check for cotransformation for 8 colonies from each. Also, since all the colony PCR's failed for my re-picking of 2114+2275, I'm going to redo the one-pot reaction for that as well.
The ligation of the atub promoter to the KA vector (Bjh2342-pMLL6-KA) was very successful, since I got a lot of colonies. I'll inoculate and run colony PCR (no need to check for co-transformation. Since my two colony picks of ef1a seemed to fail on the colony PCR yesterday, I'm going to pick a bunch more, inoculate, and run colony PCR again.
SL/VB Assembly: Redo of One Pot (with more enzyme) for 2114 combos
- One Pot (used 0.4uL of enzyme):
- 2114+2275
- 2114+2316
- Will be ready for ligase at 2:00pm. Added ligase at 2:00pm. Will be ready for transformation into RIGHTY cells at 2:30pm. Rescue started at 3:30pm.
iGEM10_020 Assembly: redo of 16a+SL assembly, starting with new L/R digests
- Redo of L/R digest of 16a and 6+24
- Put in incubator at 12:14pm. Ready for Zymo at 1:14pm. Zymo'd and added ligase at 2:00pm. Will be ready for transformation into RIGHTY cells at 2:30pm. Rescue started at 3:30pm.
Possibly successful assemblies (Animal Promoter, SL/VB and iGEM20
- Picked colonies (8 each)/inoculate/cotransformation check
- 2271+2017
- ig114+2017
- 16a+SL (pick at least 12 NEW colonies)
- atub and ef1a (no cotransformation check)
Miniprep of Payload Delivery Vectors
Miniprepped Payload Delivery stuff (in shaker w/ Mg LB)
Sequencing Results for iGEM10_017b, 2114+2316b,Bjh2345 PMLL4
Sequencing results:
- iGEM10_017b: the first 990bp or so of the 1546bp part are perfect, so I think it's safe to say that this miniprep is good to use for future assembly.
- 2114+2316b: this proved to have the Pcon, but no vacuole buster in the part. At first I thought this was odd, since the part miniprepped well, but it makes sense now. The part had a bad colony PCR since only the 43bp pCon was in the vector. The part had what looked like a good miniprep map since the vector was the same size as the part, and I when I saw a band, I assumed it was the part AND the vector. My mistake.
- Bjh2345 PMLL4: bad read. Do again, but make sure concentration is accurate?
Amy N. Kristofferson 13:49, 6 July 2010 (EDT)
Colony PCR results for all colonies picked today
Note: they ALL look horrible. Bands in the 16a lanes are probably from cotransformation with 16a vector, since that part is about 850bp.
| Lane | Part | Expected length |
| 1 | 2114+2275 repick | 3622 |
| 2 | \" | |
| 3 | \" | |
| 4 | \" | |
| 5 | \" | |
| 6 | \" | |
| 7 | \" | |
| 8 | \" | |
| 9 | 16a+SL | 3566 |
| 10 | \" | |
| 11 | \" | |
| 12 | \" | |
| 13 | 16b+SL | 3566 |
| 14 | \" | |
| 15 | \" | |
| 16 | \" | |
| 17 | ef1a | 1088 |
| 18 | \" | |
Transposase Assembly: Colony PCR of iGEM10_016a,b with Self Lysis Device
Picked 4 colonies of each. Ran Colony PCR. Inoculated. Plated to check for co-transformation.
Animal Promoter: Colony PCR of Ef1a
Picked 2 colonies. Ran Colony PCR. Inoculated.
Conor Eco/Bam digested and zymo'd the atub promoter (Bjh2842). Started ligation with PMLL6-KA vector at 4:45pm. Transformed into jtk049 cells. Started rescue at 5:55pm.
Payload Delivery
Since the payload delivery device contains the Self Lysis device under a promoter that's induced in low levels of Mg, I need to grow up my colonies in LB containing 30mM Mg to prevent Lysis. In the future, I should also rescue/plate on Mg. I selected clear colonies.
Tomorrow, I will miniprep the inoculations and map the minipreps next to the parent vector containing the part, so I can make sure the whole part is in the new vector. (Jin said recombination events can occur which could shorten the part)
SL/VB Promoter Assembly
Redo one pot reaction with 2271+2071 and ig114+2071
Conor set up two one pot reactions and put them in the thermocycler under my ONEPOT program. Added ligase at 4:45pm. Will transform into LEFTY cells. Started rescue at 5:55pm.
Picked more colonies for 2114+2275, since miniprep mapping failed
Pick 8 more colonies from 2114+2275. Ran colony PCR, inoculate, check for cotransformation.
Summary of Results so far
| Part | Transformation | Miniprep Map | Colony PCR for that Miniprep | To do |
| 2114+2316 | good | good | bad | Seq |
| 2114+2275 | good | bad | bad | repick colonies |
| 2271+2071 | bad | N/A | N/A | redo one-pot |
| ig114+2071 | ok | bad | good | redo one-pot |
| 2345-pMLL4 | good | good | bad | Seq |
For whatever reason, my Colony PCR results and miniprep results don't seem to ever correspond.
Amy N. Kristofferson 19:16, 5 July 2010 (EDT)
SL/VB Promoter Assembly: Mapping the minipreps produced from Round 1 and 2345 Redo
Started digestion at 5:18pm. Will be ready for the gel at 5:48pm.
| Tube | Part | Methylated? | Digest | Color | Expected Lengths (part, plasmid) | Good? | Sequence | Next step | |
| 1 | 2114+2316a | R | Eco/Xho | CK | 4058, 1466 | good | yes | ||
| 2 | 2114+2316b | possibly good | yes | ||||||
| 3 | 2114+2275b | R | Eco/Xho | CK | 4627, 1466 | BAD | Pick more colonies | ||
| 4 | 2114+2275c | BAD | |||||||
| 5 | ig114+2017 | L | Eco/Bam | AC | 2925, 2745 | BAD | redo | ||
| 6 | 2345 in pMLL4a | L | Eco/Bam | AC | 2680, 2745 | good | yes | ||
| 7 | 2345 in pMLL4b | good | |||||||
| 8 | 2345 in pMLL4c | good | |||||||
Transposase Assembly: Ligation of iGEM10_016a,b Lefty digest with 6+24 Righty digest
Started ligation at 4:05pm. Ligated unmethylated 6+24 digested with BglII+XhoI with both unmethylated iGEM10_016a+b, which had been digested with BamHI+XhoI. Tubes are labelled 16a+SL and 16b+SL (SL meaning Self Lysis, which is part 6).
After ligation is over, I will transform into RIGHTY cells. Started rescue at 5:05pm. Plated on CA.
Animal Promoter: Ligate Ef1a Eco/Bam digest of PCR product with PMLL6-KA
Started ligation at 4:05pm. Ligated Ef1a Eco/Bam digest of PCR product with pre-digested PMLL6-KA.
After ligation is over, I will transform into LEFTY cells. Started rescue at 5:05pm. Plated on KA.
Payload: Ligation of Bjh2348 and 2291 with Pjh1601K
Started ligation at 4:05pm. Ligated Eco/Bam digests of Bjh2291 and 2348 with my Eco/Bam digested Pjh1601K plasmid.
After ligation is over, I will transform into jtk049 cells, because they don't need to be methylated. Started rescue at 5:05pm. Plated on K.
Amy N. Kristofferson 13:00, 2 July 2010 (EDT)
Transposase Assay Take 2: Testing time for Transposase expression and time for transposase activity
- Each inoculation contains about 4mL of cells. Move 1000uL of cells into four flasks.
- Each flask contains 900uL of cells.
- Add 10uL of arabinose for each mL of cells at t=o, 1 hour, 2 hours, 3 hours.
- Since arabinose is 100x, will add 9uL of arabinose to each flask
- Added first 9uL at 10:49am.
- Added second 9uL at 11:49am
- After four hours have passed since you first added arabinose, add 1uL of atc per mL of cells. Allow 1 hour for lysis.
- Will add 0.9uL of atc, since 900uL of cells are being used and the concentration of the atc is 1000x.
- After that one hour, add 5uL of DNA to each tube.
- Remove a 200uL sample of lysate after 30min, 1 hour, 1.5hour, 2hours.
- Immediately after removal, spin down the lysate and zymo the supernatant.
- Transform lefty pir+ cells with the lysate. Plate on Amp and Gen.
Unfortunate update: Sequencing proved that iGEM10_020b is a dud. Gibson didn't work because one of our junctions contained palidromic terminal repeats, so the oligos designed based off those junctions didn't have a unique binding site. Oh well. We'll proceed with manual 2ab assembly.
iGEM10_20 2ab Assembly
Mapping of iGEM10_016 minipreps a and b
An Eco/Bam digest of iGEM10_16 in PMLL5-CK should result in bands at 2662 and 867.
Note: iGEM10_017 has already been mapping. (see below) Results were slightly confusing, so I'll submit it for sequencing...? iGEM10_001 was also mapped, and looks good. 1a-c are all good options.
Started digestion at 4:55pm.
Both have bands at the appropriate places, but 16b has a lot more parent vector remaining, for whatever reason, so 16a is probably the best choice.
Assembly of iGEM10_018
Lefty Digest of iGEM10_16
Righty Digest of Self Lysis Device (6+24 taken from well G10 of ROMEO plate) Started at 4:42pm. Zymo'd and stored in my working box.
SL/VB Promoter Manual Assembly: Analysis of One-Pot reaction
2114+2316 and 2114+2275 both successfully transformed righty pir+ cells. The plates are covered in colonies. 2271+2017 and ig114+2071 weren't as successful. The former had no colonies, while the latter had 11, which is surprising, because I used barely any DNA.
I will pick four colonies from each, colony pcr, inoculate, and check for cotransformation.
Cotransformation results:
The ones with letters in the corners were chosen for minipreps.
| Tube | Combo | Expected length | Good? | co-transformed? | miniprep? |
| 1 | 2114+2316 | 3053 | yes | no | yes |
| 2 | \" | no | yes | ||
| 3 | \" | ||||
| 4 | \" | no | |||
| 5 | ig114+2017 | 3125 | yes | no | yes |
| 6 | \" | yes | |||
| 7 | \" | yes | |||
| 8 | \" | ||||
| 9 | 2345 in pMLL4 | 2880 | no | yes | |
| 10 | \" | no | yes | ||
| 11 | \" | no | yes | ||
| 12 | \" | no | |||
| 13 | 2114+2275 | 3622 | |||
| 14 | \" | no | yes | ||
| 15 | \" | no | yes | ||
| 16 | \" | ||||
Moving into jh1601K
Performed an Eco/Bam Digest of jh1601K. Put in incubator at 11:09am. Trashed that digest. Realized I need to do a gel purification, so I'll do the digest again with 4uL of plasmid.
Started digest again at 4:54pm.
2345 Redo from 24+PMLL4 digests
The plate is covered in colonies. I will pick 8 colonies, inoculate, and check for cotransformation.
Amy N. Kristofferson 13:40, 1 July 2010 (EDT)
Eco/Bam transfer 2348 and 2291 into 1601K
Started Digest at 12:19pm.
Zymo'd and stored in my working box.
2345 Redo: Ligating Tim's ebid 24 and EB pMLL4-AC
Since my Colony PCR turned out so horribly yesterday, and 2345 is the Self Lysis Device we've been using for all our construction, I'm just going to use Tim's digests and ligate them together.
Started ligation at 11:48am.
I transformed the plasmid into lefty pir+ cells. Started rescue around 12:30pm. Plated on AC at 2:13pm.
One Pot Assembly of Jin's Parts
I'm going to redo the construction of the following with a one pot reaction, since they're all methylated.
| Lefty Digest | Righty Digest | Transform into | Plate on | Short Description | ' |
| 2114 | 2316 | R | CK | pCon.VacuoleBusterA | |
| 2114 | 2275 | R | CK | pCon.VacuoleBusterB | |
| 2271 | 2017 | L | AC | Pbad.SelfLysisT | |
| ig114 | 2017 | L | AC | Ptet.SelfLysisT | |
Started digest at 11:10am, for all but ig114+2017. I added the speck of 2017 (~.2uL) left at around 11:36am. Started the 20 min heat kill for all but ig114+2017 at 12:30pm. Accidently set the heat kill program for 20 sec instead of minutes and added ligase. Hopefully that won't hurt anything. Put all four tubes in the PCR machine to heat kill at 12:53pm. Added ligase at 1:41pm. Started rescue at 2:42pm.
These numbers have been based on Qiagen minipreps of Jin's pBjh1601
assembly vectors:
- Set up the digestion:
1uL lefty plasmid(methylated) 1uL righty plasmid (methylated) 1uL NEB2+ATP 0.3 uL XhoI 0.3 uL BglII 0.3 uL BamHI 6.1uL Water
- Digest for 1 hour at 37C
- Heat kill at 65 for 20 min
- Add 0.3uL T4 Ligase
- Ligate at room temperature for 30 minutes
- Put on ice for transformation
- Transform, rescue, plate on dual antibiotic plates
Notes:
- This requires the use of BglII and BamHI methylating strains!
- 10X "NEB2+ATP" is a homemade buffer present as aliquots in 500uL
tubes labeled with a red slash
- You can make up a mastermix of the enzymes/buffer/water and
distribute the plasmids into it
- The leftmost thermocyler in 327 has a program JCA/1123 that runs the
1hr at 37 and heat kill steps of the procedure
Eco/Bam digest of EF1a PCR product
Started digest at 11:55am. Zymo'd the product.
I need to figure out what assembly vector to put it in and then map and sequence the part to make sure it's correct.





