Berk2010-Tim: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 1: Line 1:
[http://openwetware.org/wiki/IGEM:Berkeley/2010 HOME]
[http://openwetware.org/wiki/IGEM:Berkeley/2010 HOME]
==[[User:Tim Hsiau|Tim Hsiau]] 14:33, 17 July 2010 (EDT)==
Some representation data from scope sessions
[[Image:PDD test 1hr 3 (Texasred+eGFP+Phase).JPG]]
[[Image:PDD test 1hr 3 eGFP.JPG]]
[[Image:PDD test 1hr 3 Phase.JPG]]
[[Image:PDD test 1hr 3 Texasred.JPG]]
==[[User:Tim Hsiau|Tim Hsiau]] 15:09, 16 July 2010 (EDT)==
==[[User:Tim Hsiau|Tim Hsiau]] 15:09, 16 July 2010 (EDT)==
FM464 -> lysozomal dye?
FM464 -> lysozomal dye?
Line 8: Line 15:


galena crystals -> choano's like to adhere to this, so we can fix their orientation
galena crystals -> choano's like to adhere to this, so we can fix their orientation
==[[User:Tim Hsiau|Tim Hsiau]] 15:27, 15 July 2010 (EDT)==
==[[User:Tim Hsiau|Tim Hsiau]] 15:27, 15 July 2010 (EDT)==
===Zeiss Scope protocol===
===Zeiss Scope protocol===

Revision as of 11:33, 17 July 2010

HOME

Tim Hsiau 14:33, 17 July 2010 (EDT)

Some representation data from scope sessions

Tim Hsiau 15:09, 16 July 2010 (EDT)

FM464 -> lysozomal dye?

pH dependent dyes?

nuyclear membrane dye -> To pro and DAPI

galena crystals -> choano's like to adhere to this, so we can fix their orientation

Tim Hsiau 15:27, 15 July 2010 (EDT)

Zeiss Scope protocol

Phase 2       20x
Phase 3       63 or 100x

To initialize the focus, put on 20X, make diaphragm as small as possible, focus the edges and center the window. Open up the diaphragm until it is just past the edges of the field of view.

For oil objectives, put oil on the objective every couple of slides. Bring up until the oil touches the slide -> switch to phase 3.

Tim Hsiau 16:46, 29 June 2010 (EDT)

  1. Try lifeact on choano and mammalian cells
    1. make {Ptet}{rbs_LifeAct_GDPPVAT>}{<RFP!}
  2. talk to king lab, get list of proteins that we should fuse gfp to
  3. take pictures of constructs that looked like they worked
  4. when tet promoter works, test that
  5. test purely pb6 and gfp, no PDD, grow up in media w/ no Mg (N-minimal media), feed to choanos, compare w/ bacteria grown in normal media, positive control -> NH4Cl, to test if pB6 works to delay digestion
  6. delivering plasmids
    1. p15A Kan-only, ecobam transfer 2348, 2291, then use cells w/ tera's plasmid and feed them to choano's

Tim Hsiau 17:57, 8 June 2010 (EDT)

tomorrow:

  1. pick 1061 lefty/righty cells -> make glycerol stock
  2. make glycerol stock of pB6, miniprep
  3. make comp cells of the 1256 stuff, transform with pB6
  4. make list of lefty/righty transformations, make sure we have all basic parts

Tim Hsiau 15:19, 7 June 2010 (EDT)

Need to make MG1655 comp cells

TOPO 2.1 sequence

ccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcaggatcgatccagacatgataagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaagttaacaacaacaattgcattcattttatgtttcaggttcagggggaggtgtgggaggttttttaaagcaagtaaaacctctacaaatgtggtatggctgattatgatcatgaacagactgtgaggactgaggggcctgaaatgagccttgggactgtgaatctaaaatacacaaacaattagaatcactagctcctgtgtataatattttcataaatcatactcagtaagcaaaactctcaagcagcaagcatatgcagctagtttaacacattatacacttaaaaattttatatttaccttagagctttaaatctctgtaggtagtttgtccaattatgtcacaccacagaagtaaggttccttcacaaagatcccaagctagcttataatacgactcactatagggagagagctatgacgtcgcatgcacgcgtaagcttgggcccctcgagggatcctctagagcggccgccgactagtgagctcgtcgacccgggaattccggaccggtacctgcaggcgtaccttctatagtgtcacctaaatagctttttgcaaaagcctaggctagagtccggaggctggatcggtcccggtgtcttctatggaggtcaaaacagcgtggatggcgtctccaggcgatctgacggttcactaaacgagctctgcttatatagacctcccaccgtacacgcctaccgcccatttgcgtcaatggggcggagttgttacgacattttggaaagtcccgttgattttggtgccaaaacaaactcccattgacgtcaatggggtggagacttggaaatccccgtgagtcaaaccgctatccacgcccattgatgtactgccaaaaccgcatcaccatggtaatagcgatgactaatacgtagatgtactgccaagtaggaaagtcccataaggtcatgtactgggcataatgccaggcgggccatttaccgtcattgacgtcaatagggggcgtacttggcatatgatacacttgatgtactgccaagtgggcagtttaccgtaaatactccacccattgacgtcaatggaaagtccctattggcgttactatgggaacatacgtcattattgacgtcaatgggcgggggtcgttgggcggtcagccaggcgggccatttaccgtaagttatgtaacgacctgcacgatgctgtttcctgtgtgaaattgttatccgctcacaattccacacattatacgagccggaagctataaagtgtaaagcctggggtgcctaatgagtgaaagggcctcgtatacgcctatttttataggttaatgtcatgataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaacgcgcgaattgcaagctctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcaatgctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgccataacttcgtatagcatacattatacgaagttatggcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgccaggggtgggcacacatatttgataccagcgatccctacacagcacataattcaatgcgacttccctctatcgcacatcttagacctttattctccctccagcacacatcgaagctgccgagcaagccgttctcaccagtccaagacctggcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgaaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtc

not sure if ef1a is inserted revcomp relative to this seq

  • Hey Tim this is Christoph. It IS inserted revcomp relative to this sequence.

Tim Hsiau 20:13, 4 June 2010 (EDT)

Talked to Jin about payload delivery device

first column is PDD: payload delivery device

second column is the payload plus some stuff that may inhibit vacuole merging (secretion system)

third column is the BAC that contains other secretion system components

PDD's are not stable, need to make competent cells of BAC plus payload and do fresh transforms of PDD's everytime you assay

We have to work with MG1655 for assays, other strains okay for cloning

Other notes:

Mg needs to be added for all steps of cloning the PDD's
1M MgSO4
10µL into rescue step (after heatshock)
400µL spread on plate (if +Spec, add 20µL and spread)
30µL into ea mL TB media (use TB for growing up for assay)