BioMicroCenter:DNA HTL

HOME --

SEQUENCING --

LIBRARY PREP --

HIGH-THROUGHPUT --

COMPUTING --

OTHER TECHNOLOGY

The BioMicro Center offers high-throuhgput DNA library preparation for NexteraXT samples and for metagenomics/amplicon generation. High-throughput library generation is different from standard library preparation in a couple key ways. First, with dozens of samples to prepare, small numbers of samples may fail and the cost of reprepping those samples is NOT included in the quoted cost. For some experiments, repreps can be done by hand, but at a higher rate. Second, we are focused far more on reducing price than for standard library preparation, so some "routine services" - such as quality control or arraying of samples - is not built in.

High-Throughput Nextera XT

To minimize library prep costs for standard Illumina libraries, we have automated Illumina NexteraXT on our Tecan EVO150s. Libraries will be built to include variable i5 and i7 indexes based on the grid so dual indexing is required during sequencing of these libraries. For more information about how Nextera works, please check out the standard Nextera library preparation section of standard DNA library prep.

Plate setup
Batch Size	16
Sample Layout	Columns from left
Volume	>7ul
Concentration	0.2ng/ul*
Buffer	H2O or 10mM Tris 8.0. no organics!
Plate	Axygen 96well (CAT#)
Additional services available can be added if samples are not submitted as above	Sample setup (per 48) SPRI cleanup (if not clean in proper buffer) Advanced Analytical (if not quantified).
* For short PCR fragments, lower concentrations are required. Please speak with BMC staff for amplicons.

16S / Amplicon Sequencing

The BioMicro Center offers 16S amplicon sequencing for metagenomics projects. Derived from the Alm Lab with support from a pilot grant from MIT CEHS, our protocol uses a two step amplification to first expand the 16S population and add defined 3' and 5' sequences which are then used to add Illumina anchors and sequences. This two step method allows easy multiplexing and the ability change the amplicon insert sequence at minimal cost.

The adapter sequences - Green:Blue - are the key element of this method. On the 5' end, they contain a "YRYR" sequence that introduces the complexity required for Illumina sequencing.

FORWARD: ACACGACGCTCTTCCGATCTYRYRXXXXXXXXXX (X = insert element)
REVERSE: CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCTXXXXXXXXXXXX 

Standard BioMicro Center primers include sequences for the V4 region (highlighted). We have recently acquired the primers for v1-3 as well. Similar strategies can be used to amplify 18S or any other sequence.

The most common source of failures for 16S sequencing are samples that fail to amplify in the initial qPCR. The first step of the process is a qPCR using the forward and reverse primers to determine the number of cycles to be used in library generation. Libraries that fail to amplify in 20 cycles generally preform poorly enough to be unusable. Removal of PCR inhibitors is critical to success of this protocol. The BioMicro Center generally recommends 250PE or 300PE MiSeq kits for sequencing 16S libraries.

Plate setup
Batch Size	48*
Sample Layout	Columns from left
Volume	>5ul
Concentration	Iniital qPCR for target has Ct < 20
Buffer	H2O or 10mM Tris 8.0. no organics!
Plate	Axygen 96well (CAT#)
Additional services available can be added if samples are not submitted as above	Sample setup (per 48) SPRI cleanup (if not clean in proper buffer)
* The BioMicro Center *strongly* encourages the inclusion of 3 negative and 1 positive control samples within each batch of 48.