Biomod/2011/Caltech/DeoxyriboNucleicAwesome/Sequence Design: Difference between revisions
Line 8: | Line 8: | ||
==List of Domains== | ==List of Domains== | ||
__TOC__ | |||
===Probe Domains=== | |||
The length of these sequences is 20 nucleotides. | |||
{|style="border-collapse: separate; border-spacing: 0; border-width: 1px; border-style: solid; border-color: #000;" cellpadding="5" | |||
|- | |||
<!--Headings--> | |||
!style="border-style: solid; border-width: 0 1px 1px 0"| Domain Name | |||
!style="border-style: solid; border-width: 0 0 1px 0"| Sequence (5' → 3') | |||
!style="border-style: solid; border-width: 0 0 1px 1px"| Complement Sequence (5' → 3') | |||
|- | |||
|style="border-style: solid; border-width: 0 1px 1px 0"| P<sub>tr1</sub> | |||
|style="border-style: solid; border-width: 0 0 1px"| CCAACTCAACCCATTTCATC | |||
|style="border-style: solid; border-width: 0 0 1px 1px"| GATGAAATGGGTTGAGTTGG | |||
|- | |||
|style="border-style: solid; border-width: 0 1px 1px 0"| P<sub>tr2</sub> | |||
|style="border-style: solid; border-width: 0 0 1px"| TACATACACCAACCTCCACC | |||
|style="border-style: solid; border-width: 0 0 1px 1px"| GGTGGAGGTTGGTGTATGTA | |||
|- | |||
|style="border-style: solid; border-width: 0 1px 1px 0"| lp<sup>†</sup> | |||
|style="border-style: solid; border-width: 0 0 1px"| TTTTTTTTTTTTTTTTTTTTTTTTTTT | |||
|style="border-style: solid; border-width: 0 0 1px 1px"| AAAAAAAAAAAAAAAAAAAAAAAAAAA | |||
|- | |||
|style="border-style: solid; border-width: 0 1px 1px 0"| up<sub>ca</sub> | |||
|style="border-style: solid; border-width: 0 0 1px"| ACCTTACCTCTCCCTAACTT | |||
|style="border-style: solid; border-width: 0 0 1px 1px"| AAGTTAGGGAGAGGTAAGGT | |||
|- | |||
|style="border-style: solid; border-width: 0 1px 1px 0"| up<sub>cg</sub> | |||
|style="border-style: solid; border-width: 0 0 1px"| ACTAACTCCTACCCACACCT | |||
|style="border-style: solid; border-width: 0 0 1px 1px"| AGGTGTGGGTAGGAGTTAGT | |||
|- <!--Last Row: It's different from the others--> | |||
|style="border-style: solid; border-width: 0 1px 0 0"| P<sub>wg</sub> | |||
|style="border-style: solid; border-width: 0"| CCTCTTTCTTATCACTTCAA | |||
|style="border-style: solid; border-width: 0 0 0 1px"| TTGAAGTGATAAGAAAGAGG | |||
|} | |||
<small>† The lp domain is 27 nucleotides long.</small> | |||
==List of Strands== | ==List of Strands== | ||
{{Template:DeoxyriboNucleicAwesomeFooter}} | {{Template:DeoxyriboNucleicAwesomeFooter}} |
Revision as of 17:29, 30 June 2011
Friday, April 26, 2024
|
Sequence DesignDesign ProcessAfter having designed our mechanism at the domain level, we needed to fill in our domains with actual sequences. To start, we picked specific lengths for each of our domains. We decided to stick with the general precedent that toeholds be 6 nucleotides in length, then decided that any domain that was part of a probe be 20 nucleotides in length, as this length is both not wastefully long and long enough to ensure that no spontaneous dissociation would occur. We then decided that any domain longer than a toehold, but not part of the probe system should be 15 base pairs in length, as this would not spontaneously dissociate, but could be easily strand displaced. After these numbers were decided, we consulted a list of 20 nucleotide sequences that are known to be relatively inert and chose sequences from this list to fill in our 20 and 15 nucleotide domains. We used NUPACK and a little trial and error to find our 7 necessary relatively inert toeholds. We then ran a number of simulations in NUPACK to check for unwanted secondary structures and interactions in our designed sequences. List of DomainsProbe DomainsThe length of these sequences is 20 nucleotides.
† The lp domain is 27 nucleotides long. List of Strands |