Biomod/2011/Caltech/DeoxyriboNucleicAwesome/Sequence Design: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
mNo edit summary
Line 11: Line 11:
===Probe Domains===
===Probe Domains===
The length of these sequences is 20 nucleotides.
The length of these sequences is 20 nucleotides.
{|style="border-collapse: separate; border-spacing: 0; border-width: 1px; border-style: solid; border-color: #000;" cellpadding="5"
{|style="border-collapse: separate; border-spacing: 0; border-width: 1px; border-style: solid; border-color: #aaaaaa;" cellpadding="5"
|-  
|-  


<!--Headings-->
<!--Headings-->
!style="border-style: solid; border-width: 0 1px 1px 0"| Domain Name
!style="border-style: solid; background-color:#f2f2f2; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Domain Name
!style="border-style: solid; border-width: 0 0 1px 0"| Sequence (5' → 3')
!style="border-style: solid; background-color:#f2f2f2; border-color: #aaaaaa; border-width: 0 0 1px 0"| Sequence (5' → 3')
!style="border-style: solid; border-width: 0 0 1px 1px"| Complement Sequence (5' → 3')
!style="border-style: solid; background-color:#f2f2f2; border-color: #aaaaaa; border-width: 0 0 1px 1px"| Complement Sequence (5' → 3')
|-
|-
|style="border-style: solid; border-width: 0 1px 1px 0"| P<sub>tr1</sub>
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| P<sub>tr1</sub>
|style="border-style: solid; border-width: 0 0 1px"| CCAACTCAACCCATTTCATC
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| CCAACTCAACCCATTTCATC
|style="border-style: solid; border-width: 0 0 1px 1px"| GATGAAATGGGTTGAGTTGG
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GATGAAATGGGTTGAGTTGG


|-
|-
|style="border-style: solid; border-width: 0 1px 1px 0"| P<sub>tr2</sub>
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| P<sub>tr2</sub>
|style="border-style: solid; border-width: 0 0 1px"| TACATACACCAACCTCCACC
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| TACATACACCAACCTCCACC
|style="border-style: solid; border-width: 0 0 1px 1px"| GGTGGAGGTTGGTGTATGTA
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| GGTGGAGGTTGGTGTATGTA


|-
|-
|style="border-style: solid; border-width: 0 1px 1px 0"| lp<sup>†</sup>
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| lp<sup>†</sup>
|style="border-style: solid; border-width: 0 0 1px"| TTTTTTTTTTTTTTTTTTTTTTTTTTT
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| TTTTTTTTTTTTTTTTTTTTTTTTTTT
|style="border-style: solid; border-width: 0 0 1px 1px"| AAAAAAAAAAAAAAAAAAAAAAAAAAA
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| AAAAAAAAAAAAAAAAAAAAAAAAAAA


|-
|-
|style="border-style: solid; border-width: 0 1px 1px 0"| up<sub>ca</sub>
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| up<sub>ca</sub>
|style="border-style: solid; border-width: 0 0 1px"| ACCTTACCTCTCCCTAACTT
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| ACCTTACCTCTCCCTAACTT
|style="border-style: solid; border-width: 0 0 1px 1px"| AAGTTAGGGAGAGGTAAGGT
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| AAGTTAGGGAGAGGTAAGGT


|-
|-
|style="border-style: solid; border-width: 0 1px 1px 0"| up<sub>cg</sub>
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| up<sub>cg</sub>
|style="border-style: solid; border-width: 0 0 1px"| ACTAACTCCTACCCACACCT
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| ACTAACTCCTACCCACACCT
|style="border-style: solid; border-width: 0 0 1px 1px"| AGGTGTGGGTAGGAGTTAGT
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| AGGTGTGGGTAGGAGTTAGT


|- <!--Last Row: It's different from the others-->
|- <!--Last Row: It's different from the others-->
|style="border-style: solid; border-width: 0 1px 0 0"| P<sub>wg</sub>
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 0 0"| P<sub>wg</sub>
|style="border-style: solid; border-width: 0"| CCTCTTTCTTATCACTTCAA
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0"| CCTCTTTCTTATCACTTCAA
|style="border-style: solid; border-width: 0 0 0 1px"| TTGAAGTGATAAGAAAGAGG
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 0 1px"| TTGAAGTGATAAGAAAGAGG
|}
|}
<small>† The lp domain is 27 nucleotides long.</small>
<small>† The lp domain is 27 nucleotides long.</small>
Line 53: Line 53:
===Toehold Domains===
===Toehold Domains===
The length of these sequences is 7 nucleotides.
The length of these sequences is 7 nucleotides.
{|style="border-collapse: separate; border-spacing: 0; border-width: 1px; border-style: solid; border-color: #000;" cellpadding="5"
|-
<!--Headings-->
!style="border-style: solid; border-width: 0 1px 1px 0"| Domain Name
!style="border-style: solid; border-width: 0 0 1px 0"| Sequence (5' → 3')
!style="border-style: solid; border-width: 0 0 1px 1px"| Complement Sequence (5' → 3')
|-
|style="border-style: solid; border-width: 0 1px 1px 0"| P<sub>tr1</sub>
|style="border-style: solid; border-width: 0 0 1px"| CCAACTCAACCCATTTCATC
|style="border-style: solid; border-width: 0 0 1px 1px"| GATGAAATGGGTTGAGTTGG
|-
|style="border-style: solid; border-width: 0 1px 1px 0"| P<sub>tr2</sub>
|style="border-style: solid; border-width: 0 0 1px"| TACATACACCAACCTCCACC
|style="border-style: solid; border-width: 0 0 1px 1px"| GGTGGAGGTTGGTGTATGTA


|-
|style="border-style: solid; border-width: 0 1px 1px 0"| lp
|style="border-style: solid; border-width: 0 0 1px"| TTTTTTTTTTTTTTTTTTTTTTTTTTT
|style="border-style: solid; border-width: 0 0 1px 1px"| AAAAAAAAAAAAAAAAAAAAAAAAAAA
|-
|style="border-style: solid; border-width: 0 1px 1px 0"| up<sub>ca</sub>
|style="border-style: solid; border-width: 0 0 1px"| ACCTTACCTCTCCCTAACTT
|style="border-style: solid; border-width: 0 0 1px 1px"| AAGTTAGGGAGAGGTAAGGT
|-
|style="border-style: solid; border-width: 0 1px 1px 0"| up<sub>cg</sub>
|style="border-style: solid; border-width: 0 0 1px"| ACTAACTCCTACCCACACCT
|style="border-style: solid; border-width: 0 0 1px 1px"| AGGTGTGGGTAGGAGTTAGT
|- <!--Last Row: It's different from the others-->
|style="border-style: solid; border-width: 0 1px 0 0"| P<sub>wg</sub>
|style="border-style: solid; border-width: 0"| CCTCTTTCTTATCACTTCAA
|style="border-style: solid; border-width: 0 0 0 1px"| TTGAAGTGATAAGAAAGAGG
|}




===Other Domains===
===Other Domains===
The length of these sequences is 15 nucleotides.
The length of these sequences is 15 nucleotides.
{|style="border-collapse: separate; border-spacing: 0; border-width: 1px; border-style: solid; border-color: #000;" cellpadding="5"
|-
<!--Headings-->
!style="border-style: solid; border-width: 0 1px 1px 0"| Domain Name
!style="border-style: solid; border-width: 0 0 1px 0"| Sequence (5' → 3')
!style="border-style: solid; border-width: 0 0 1px 1px"| Complement Sequence (5' → 3')
|-
|style="border-style: solid; border-width: 0 1px 1px 0"| P<sub>tr1</sub>
|style="border-style: solid; border-width: 0 0 1px"| CCAACTCAACCCATTTCATC
|style="border-style: solid; border-width: 0 0 1px 1px"| GATGAAATGGGTTGAGTTGG
|-
|style="border-style: solid; border-width: 0 1px 1px 0"| P<sub>tr2</sub>
|style="border-style: solid; border-width: 0 0 1px"| TACATACACCAACCTCCACC
|style="border-style: solid; border-width: 0 0 1px 1px"| GGTGGAGGTTGGTGTATGTA
|-
|style="border-style: solid; border-width: 0 1px 1px 0"| lp<sup>†</sup>
|style="border-style: solid; border-width: 0 0 1px"| TTTTTTTTTTTTTTTTTTTTTTTTTTT
|style="border-style: solid; border-width: 0 0 1px 1px"| AAAAAAAAAAAAAAAAAAAAAAAAAAA
|-
|style="border-style: solid; border-width: 0 1px 1px 0"| up<sub>ca</sub>
|style="border-style: solid; border-width: 0 0 1px"| ACCTTACCTCTCCCTAACTT
|style="border-style: solid; border-width: 0 0 1px 1px"| AAGTTAGGGAGAGGTAAGGT
|-
|style="border-style: solid; border-width: 0 1px 1px 0"| up<sub>cg</sub>
|style="border-style: solid; border-width: 0 0 1px"| ACTAACTCCTACCCACACCT
|style="border-style: solid; border-width: 0 0 1px 1px"| AGGTGTGGGTAGGAGTTAGT
|- <!--Last Row: It's different from the others-->
|style="border-style: solid; border-width: 0 1px 0 0"| P<sub>wg</sub>
|style="border-style: solid; border-width: 0"| CCTCTTTCTTATCACTTCAA
|style="border-style: solid; border-width: 0 0 0 1px"| TTGAAGTGATAAGAAAGAGG
|}
<small>† The lp domain is 27 nucleotides long.</small>


==List of Strands==
==List of Strands==
{{Template:DeoxyriboNucleicAwesomeFooter}}
{{Template:DeoxyriboNucleicAwesomeFooter}}

Revision as of 17:42, 30 June 2011

Thursday, April 25, 2024

Home

Members

Project

Protocols

Progress

Discussion

References


Sequence Design

Design Process

After having designed our mechanism at the domain level, we needed to fill in our domains with actual sequences. To start, we picked specific lengths for each of our domains. We decided to stick with the general precedent that toeholds be 6 nucleotides in length, then decided that any domain that was part of a probe be 20 nucleotides in length, as this length is both not wastefully long and long enough to ensure that no spontaneous dissociation would occur. We then decided that any domain longer than a toehold, but not part of the probe system should be 15 base pairs in length, as this would not spontaneously dissociate, but could be easily strand displaced.

After these numbers were decided, we consulted a list of 20 nucleotide sequences that are known to be relatively inert and chose sequences from this list to fill in our 20 and 15 nucleotide domains. We used NUPACK and a little trial and error to find our 7 necessary relatively inert toeholds. We then ran a number of simulations in NUPACK to check for unwanted secondary structures and interactions in our designed sequences.

List of Domains

Probe Domains

The length of these sequences is 20 nucleotides.

Domain Name Sequence (5' → 3') Complement Sequence (5' → 3')
Ptr1 CCAACTCAACCCATTTCATC GATGAAATGGGTTGAGTTGG
Ptr2 TACATACACCAACCTCCACC GGTGGAGGTTGGTGTATGTA
lp TTTTTTTTTTTTTTTTTTTTTTTTTTT AAAAAAAAAAAAAAAAAAAAAAAAAAA
upca ACCTTACCTCTCCCTAACTT AAGTTAGGGAGAGGTAAGGT
upcg ACTAACTCCTACCCACACCT AGGTGTGGGTAGGAGTTAGT
Pwg CCTCTTTCTTATCACTTCAA TTGAAGTGATAAGAAAGAGG

† The lp domain is 27 nucleotides long.


Toehold Domains

The length of these sequences is 7 nucleotides.


Other Domains

The length of these sequences is 15 nucleotides.

List of Strands