      <style type="text/css">

/* ====================

  主に全体に関わるCSS

　　　==================== */

      body {behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);}

      .clear {clear:both;}

body.mediawiki {

                       font-size: 14px;

background-color:#707070; background-position: center center; background-attachment: fixed; background-repeat: no-repeat; font-family: Calibri, Verdana, helvetica, sans-serif; }

               h1 {
                       padding: 0px 20px 5px 20px;
                       font-size: 34px;
                       font-weight: bold;
               }
               h2 {
                       padding: 20px 20px 5px 20px;
                       font-size: 25px;
                       color: #0083eb;
                       text-decoration: none;
                       font-weight: bold;}
                       border: none;
               h2 a {
                       color: #eb8300;
               }
               h3 {
                       padding: 20px 20px 5px 20px;
                       font-size: 20px;
                       color: #000;
                       font-decoration: none;
                       font-weight: bold;
               }
               h1.firstHeading {

display: none;

p { text-align: justify; } a:link { color: #00a5ea; text-decoration: none } a:visited { color:#00a5ea; text-decoration: none } a:hover {

                       color: #eb8300;

text-decoration: none } a:active { color:#f29400; text-decoration: none } #bodyContent {

                       width: 970px;
                       margin: 0px 0px 0px;
                       background-color:#ffffff;
                       border-width: 0px 1px 0px 1px;
                       border-color: #000000;
               }
               #content {
                       padding-left: 0px; width: 970px;
               }

table#team_members {

                       text-align: justify;
                       border: 0;
               }

table#team_members h2, table#team_members h3 {

                       clear: both;
               }

#content * a:hover {

                       text-decoration:none;
               }

#main_wrapper {

                       position:absolute;
                       left:0px;
                       top:20px;

margin-top: 0; width: 969px; height: 221px; align: center; border-style: solid;

                       border-color: white;

} /* ====================

  メニューの画像を変更できる部分
  ==================== */

#header {

                       position:relative;
                       left:0px;
                       top:0px;

margin-top: 0; width: 969px; height: 221px; align: left; background-color: #FFFFFF;

                       background-image: url(http://openwetware.org/images/e/e0/NEW_header.jpg);

} /* ====================

  以下、特殊なclassに適用される
  ==================== */

#navigation { position:absolute;

                       left:18px; top:155px; width:1200px; height:69px;

z-index:100;

                       background-color: transparent;
                       float: left;

color: #0000FF; } #super_main_wrapper {

                       position:absolute;
                       left:0px;
                       top:227px;

width: 975px; align: center; background-color: #ede8e2;

                       heigth: auto;
               }
               #SubWrapper {
                       width: 645px;
                       padding: 0px;
                       border-left:4px solid #ede8e2;
                       float: left;
                       margin-top: 0px;
                       background-color: #ede8e2;
               }
               #SubWrapper * p, #SubWrapper p  {
                       padding: 0 20px;
                       text-align: justify;
                       font-size: 12px;
               }
               #SubWrapper * h3, #SubWrapper h3 {
                       padding-top: 10px;
                       font-size: 18px;
               }
               #news {
                       width: 322px;
                       margin-top: 0px;
                       float: left;
                       background-color: #d8d5d0;
                       border-right:4px solid #ede8e2;
               }
               #news p {
                       padding: 0 20px 20px 20px;
                       text-align: justify;
                       font-size: 12px;
               }
               #news h3 {
                       padding: 10px 20px;
                       font-size: 18px;
               }
               #mission_box {
                       width:650px;
                       float: left;
               }
               #team_box, #heartbeat_box, #notebook_box, #parts_box, #gallery_box, #sponsors_box, .boxy {
                       width:215px;
                       float: left;
                       padding: 10px 0 0 0;
               }
               div.tleft {
                       border-width: 0px;
                       margin:0;
                       padding:0;
                       border-color:transparent;
               }

/* ====================

  ここからプルダウン周辺のデザイン
  ==================== */

menu * {

margin: 0; padding: 0; }

menu {

behavior: url(http://www.xs4all.nl/~peterned/htc/csshover3-source.htc);  font-family: calibri, verdana, sans-serif;

       font-color: #ffffff;

font-size: 19px; background-color: transparent; float:left; padding: 12px 0 0 0; }

menu ul {

float: left; list-style: none; }

menu ul li {

background-color:transparent;

       position:relative;

float:left; list-style: none; padding: 10px 20px 0 0;

       font-weight: bold;
       width: auto;

}

menu a {

color: #FFFFFF; display: inline; text-decoration: none; }

menu a:visited {

color:#FFFFFF; text-decoration: none }

menu a:hover {

color: #00a5ea; }

menu ul li ul {

display: none; position: absolute; left: 0px;

       width: 155px;
       heigth: 1%;

font-size: 19px; opacity: 0.8; list-style: none;

       top: 30px;
       padding-top: 20px;
       z-index:500;

}

menu ul li:hover ul {

display: inline;

       background-position: bottom;

}

menu ul li ul li {

width: 100%; list-style: none;

       background-color: #000;
       margin: -1px;
       padding: 0px 0 0 5px;
       display: inline;

}

</style>

<!--[if IE]> <style type="text/css">

SubWrapper {width: 645px;}
news {width: 317px;}
super_main_wrapper {position:static;}
navigation {left: 15px;}
menu ul li ul {left: -2px; top: 22px;}

</style> <![endif]--> <div id="main_wrapper">

 <div id="header">

<div id="navigation"> <div id="menu" style="position:static"> <ul> <li><a class="aMain" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo">Home</a></li> <li><a class="aTeam" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Team/Students">Team</a></li> <li><a class="aProject" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project">Project</a>  <li><font color="#ffffff">Results</font> <ul> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Results">Experiments</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Simulations">Simulations</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Achievements/DNA_Devices">DNA Design</a></li> </ul></li>  <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Achievements">Achievements</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Project/Future_works">Future works</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Notebook/Protocols">Protocols</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Notebook/Lab.notebook">Notes</a></li> <li><a class="aNotebook" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Sponsors/">Sponsors</a></li> <li><a class="aSitemap" href="http://openwetware.org/wiki/Biomod/2011/TeamJapan/Tokyo/Sitemap">Sitemap</a></li>

</ul> </div> </div>  </div> </div>  <script type="text/javascript">

/***********************************************

CSS Vertical List Menu- by JavaScript Kit (www.javascriptkit.com)
Menu interface credits: http://www.dynamicdrive.com/style/csslibrary/item/glossy-vertical-menu/
This notice must stay intact for usage
Visit JavaScript Kit at http://www.javascriptkit.com/ for this script and 100s more

- - - - /

var menuids=new Array("verticalmenu") //Enter id(s) of UL menus, separated by commas var submenuoffset=-2 //Offset of submenus from main menu. Default is -2 pixels.

function createcssmenu(){ for (var i=0; i<menuids.length; i++){

 var ultags=document.getElementById(menuids[i]).getElementsByTagName("ul")
   for (var t=0; t<ultags.length; t++){
   var spanref=document.createElement("span")

spanref.className="arrowdiv" spanref.innerHTML="  " ultags[t].parentNode.getElementsByTagName("a")[0].appendChild(spanref)

   ultags[t].parentNode.onmouseover=function(){
   this.getElementsByTagName("ul")[0].style.left=this.parentNode.offsetWidth+submenuoffset+"px"
   this.getElementsByTagName("ul")[0].style.display="block"
   }
   ultags[t].parentNode.onmouseout=function(){
   this.getElementsByTagName("ul")[0].style.display="none"
   }
   }
 }

} if (window.addEventListener) window.addEventListener("load", createcssmenu, false) else if (window.attachEvent) window.attachEvent("onload", createcssmenu) </script>  </html>

DNA design

To achieve the DNA ciliate and its three modes, we constructed five types of DNA sequences: (1) "deoxyribozyme", attached to the body of the DNA ciliate; (2) "substrate DNA", attached to a glass plate as a DNA track for the track walking mode; (3) "UV-switching DNA", used for the UV-switching device and originally designed by ourselves; (4) "blocking DNA", used for the UV-switching device; (5) "complementary strand for deoxyribozyme", used for constantly-gathering of the DNA ciliate. All these five types of DNA strands worked as we expected (see Experimental Results). Here, we explain the sequence information and the functions of the five types of DNA strands in detail.

1.Deoxyribozyme

5' -(NH₂)-TTATTATTAT CTCTTCTCCGAGCCGGTCGAAATAGTGAAAA-3'
Size: 41 bases
- This DNA was attached to the DNA ciliate body.This DNA has enzymatic cleaving activity for the substrate DNA; i.e., deoxyribozyme. The 31 bases from 3' end of the above strand (shown in red) acts as a deoxyribozyme when it hybridizes with the substrate DNA (2). The 31 bases are same as the sequence of the DNA spider leg (CTCTTCTCCGAGCCGGTCGAAATAGTGAAAA)^[1].
- We designed the first 10 bases from 5’ end as a linker between the deoxyribozyme region and the DNA ciliate body (TTATTATTAT). This linker increased the spacing between the DNA ciliate body and the enzymatic activity area of the deoxyribozyme, and thus the deoxyribozyme area easily hybridized with the substrate DNA and exerted its enzymatic activity (see Experimental Results). In addition, we carefully designed the sequence not to cause unexpected intramolecular structures or unexpected hybridization with other DNA in the experimental system.

2.Substrate

5' -(NH₂)-TTTTTTTTTT TTTTCACTAT[rA]GGAAGAG-3'
Size: 28 bases
- The substrate DNA is used for the DNA tracks in the track walking mode. The substrate DNA contains an RNA base at the 21st base from 5' end of the DNA (shown as [rA]). When the deoxyribozyme (1) hybridizes with the substrate DNA, the substrate DNA works as an enzymatic substrete of the deoxyribozyme, resulting in the cleavage of the substrate DNA at the RNA base site. The last 18 bases from 3'end of the substrate DNA are same as the substrate of the DNA spider leg (TTTTCACTAT[rA]GGAAGAG)^[1].
- We designed the first 10 bases from 5' end as a linker (TTTTTTTTTT). This DNA was also designed not to make unexpected structures.
The 5' end was modified by an amino group (-NH₂) to be fixed on a glass plate by a silane coupling reaction.

3.UV-switching DNA

5' -(NH₂)-TTTTTT TTTTCACTATTTCGACCGGCTCGGAGAAGAG TTTTT CT X CT X TC-3'(X = azobenzene)
Size: 48 bases + 2 azobenzenes
- The UV-switching DNA was used for an anchoring-DNA spot in the light-irradiated gathering mode. The UV-switching DNA forms a stem-loop structure. The loop consists of five bases (TTTTT), and the stem (CT X CT X TC) has two trans-formed azobenzenes (X ). By UV irradiation, the azobenzenes are isomerized from the trans-form to the cis-form. As a result, the stem with the azobenzenes becomes hard to form the double strand ^[2].
  To achieve this switching, it is necessary to design the stem sequence that firmly forms the stem-loop structure at the room temperature but opens the stem-loop structure by isomerization of the two azobenzenes from trans- to cis-form. There are no reports on the opening-and-closing transition of a single molecular by azobenzenes inserted into a stem. Here, we designed the sequences “GAAGAG” and "CT X CT X TC" as the stem and "TTTTT" as the loop by thermodynamic calculations^[3].
- The 7th to 37th bases from 5' end (TTTTCACTATTTCGACCGGCTCGGAGAAGAG) is a complementary sequence for the deoxyribozyme (1). In addition, the 7th to 31th bases from 5’ end (TTTTCACTATTTCGACCGGCTCGGA) are a complementary part for blocking DNA (4) below.
  Before UV irradiation, the stem-loop structure of the UV-switching DNA forms, and the blocking DNA is hybridizing with the UV-switching DNA. Thus, the deoxyribozyme cannot hybridize with the UV-switching DNA. After UV irradiation, the branch migration of the deoxyribozyme for the UV-switching DNA starts from the stem part and the blocking DNA is released. As a result, the deoxyribozyme and the UV-switching DNA form a double strand.
- We designed the first 6 bases from 5' end as a linker (TTTTTT). This is also designed not to make unexpected structures.
- The 5' end is modified by an amino group (-NH₂) to be fixed on a glass plate by a silane coupling reaction.

4.Blocking DNA

5' -TCCGAGCCGGTCGAAATAGTGAAAA-3'
Size: 25 bases
- The blocking DNA helps to prevent the hybridization between the deoxyribozyme (1) the UV-switching DNA (3) before UV irradiation. The blocking DNA has a partly complementary sequence of the UV-switching DNA (TTTTCACTATTTCGACCG GCTCGGA); that is, the sequence of the blocking DNA is partly equal to the deoxyribozyme sequence (the 25 bases from deoxyribozyme’s 3’ end). However, the blocking DNA does not have deoxyribozyme activity because the blocking DNA does not have a special 6-base sequence needed for the deoxyribozyme activity.

5.Complementary DNA for deoxyribozyme

5' -(NH₂)-TTTTTT TTTTCACTATTTCGACCGGCTCGGAGAAGAG-3'
Size: 48 bases
The last 31 bases from 3' end (TTTTCACTATTTCGACCGGCTCGGAGAAGAG) are a complementary sequence of the deoxyribozyme, and are also equal to the 37 bases from 5' end of the UV-switching DNA. We designed the first 6 bases from 5' end as a linker (TTTTTT). This is also designed not to make unexpected structures. The 5' end is modified by an amino group (-NH₂) to be fixed on a glass plate by a silane coupling reaction.

References

[1] Kyle Lund　et al.: Molecular robots guided by prescriptive landscapes, Nature, 465, 206/210(2010)

[2] Xingguo Liang et al.: Molecular Design for Reversing the Photoswitching Mode of Turning ON and OFF DNA Hybridization, Chem. Asian J., 3, 553/560(2008)

[3] J.N. Zadeh,et al.: NUPACK: analysis and design of nucleic acid systems, J Comput Chem, 32, 170/173(2011)

Biomod/2011/TeamJapan/Tokyo/Achievements/DNA Devices

DNA design

1.Deoxyribozyme

2.Substrate

3.UV-switching DNA

4.Blocking DNA

5.Complementary DNA for deoxyribozyme

References

Navigation menu

Page actions

Page actions

Personal tools

Navigation

Search

research

Tools