Biomod/2012/TU Dresden/Nanosaurs/Project/Aptamer lock: Difference between revisions
No edit summary |
No edit summary |
||
Line 51: | Line 51: | ||
<div class="descr" align = "center">Fig. 1 When the lock and key interact, the origami box opens.</div> | <div class="descr" align = "center">Fig. 1 When the lock and key interact, the origami box opens.</div> | ||
</div> | </div> | ||
<div class="clear"></div> | |||
<p align = "justify"> | |||
For our purposes, we adapted the lock and key system based on the specific binding of PDGF (Platelet Derived Growth Factor) to an aptamer strand. | |||
Such a system has been successfully used for a similar application (Douglas et al., Science Vol 335 17 February 2012,831-834). Aptamers are | |||
artificial specific oligonucleotides, DNA or RNA, with the ability to bind to non-nucleic acid target molecules, such as peptides, proteins, drugs, organic and inorganic molecules or even whole cells, with high affinity and specificity (Mairal et al., Anal Bioanal Chem (2008) 390:989–1007). | |||
PDGF is one of the numerous proteins regulating cell growth and division. It is considered a potent activator for the cell types essential for | |||
tissue repair and wound healing(GF. Pierce et al., Biochem 1991 Apr;45(4):319-26). In our system, we used a PDGF-specific aptamer based locking system, as described by Douglas et al.. | |||
Each lock is essentially composed of two complementary oligonuleotidic strands - an aptamer strand specific to PDGF and a strand complementary to it.</p> | |||
<p><big><b>Aptamer strand: <code class="dna_blue">5'TACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA3'</code></b></big></p> | |||
<p><big><b>Aptamer locking strand: <code class="dna_green">3'ATGAGTCCCGACACGTTCGTTAACACCAGGGTTACCCGACTCAT5'</code></b></big></p> | |||
Revision as of 20:53, 27 October 2012
<html> <!--import jquery libraries--> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-1.8.2.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-ui-1.9.1.custom.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.smooth-scroll.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/lightbox.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.queryloader2.js"></script> <!-- progress preloading--> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/superfish.js"></script> <!-- menu bar--> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.hoverIntent.minified.js"></script> <!-- replaces hover for navigation--> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.scrollTo-1.4.3.1-min.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.localscroll-1.2.7-min.js"></script> <!--import webfonts--> <link href='http://fonts.googleapis.com/css?family=Merriweather:400,700' rel='stylesheet' type='text/css'> <link href='http://biomod-dresden-2012.googlecode.com/svn/trunk/css/superfish.css' rel='stylesheet' type='text/css'> <link rel="stylesheet" href="http://biomod-dresden-2012.googlecode.com/svn/trunk/css/lightbox.css" type="text/css" media="screen" /> <link rel="stylesheet" href="http://code.jquery.com/ui/1.9.0/themes/base/jquery-ui.css" /> <script type"text/javascript"> // Main function that waits for the browser to be ready $(document).ready(function(){ //make css accesible, please change the alter_css to chnage the style var alter_css = $("#alter_css").html(); $("style").remove(); $('head').append('<link rel="stylesheet" href="/skins/monobook/shared.css?164" type="text/css" />'); $('head').append('<link rel="stylesheet" href="http://biomod-dresden-2012.googlecode.com/svn/trunk/nanos.css" type="text/css" />'); //additional divs $(".firstHeading").wrap('<div id="header"></div>'); $(".firstHeading").wrap('<div id="inner_header"></div>'); $(".firstHeading").wrap('<div id="title_con"></div>'); var nav = $("#nav").html(); $('#inner_header').append(nav); $('#inner_header').append('<div class="clear"></div>'); //clean up wiki framework $("#sidebar-main").remove(); $(".portlet").remove(); //fix breadcrumbs $('#contentSub').remove(); //fix heading var h1 = $(".firstHeading").text().split("/"); $(".firstHeading").text(h1[h1.length-1]); //start plugins for navigation $("ul.sf-menu").superfish({ delay: 800, // one second delay on mouseout animation: {opacity:'show',height:'show'}, // fade-in and slide-down animation speed: 'normal', // faster animation speed }); $('#main_saurs').localScroll(); $("tr:odd").addClass("odd");
}); </script>
<script type="text/javascript"> var _gaq = _gaq || []; _gaq.push(['_setAccount', 'UA-35720700-1']); _gaq.push(['_trackPageview']);
(function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); </script> <script type="text/javascript">var addthis_config = {"data_track_addressbar":false};</script> <script type="text/javascript" src="http://s7.addthis.com/js/300/addthis_widget.js#pubid=ra-508414b242f27ceb"></script> <script id="nav"> <div id="nav"> <ul id="nav" class="sf-menu"> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs">home</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Team">team</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project">project</a> <ul> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project">overview</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project/DNA origami">dna origami</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project/Vesicles">vesicles</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project/Aptamer_lock">aptamer lock</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project/Future_work">future work</a></li> </ul> </li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Lab_book">lab book</a> <ul> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Lab_book#recipes">recipes</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Lab_book#protocols">protocols</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Lab_book#downloads">downloads</a></li> </ul> </li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Gallery">gallery</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Sponsors">sponsors</a></li> </ul> </div> </script>
</html> <html> <body>
<style> body{ width:960px; margin:auto; } </style>
<link rel="stylesheet" href="http://code.jquery.com/ui/1.9.0/themes/base/jquery-ui.css" />
<link rel="stylesheet" href="http://biomod-dresden-2012.googlecode.com/svn/trunk/nanos.css" />
<script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-1.8.2.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-ui-1.9.1.custom.min.js"></script> <script> $(function() { $( "#tabs" ).tabs(); }); </script>
<div id="tabs" class="tabs-bottom">
<ul> <li><a href="#tabs-1">Lock and Key</a></li> <li><a href="#tabs-2">Experimental Methods </a></li> <li><a href="#tabs-3">Challenges Faced</a></li> </ul>
<div id="main_saurs">
<div class="tabs-spacer"></div>
<div id="tabs-1">
<h2>Lock and Key</h2>
<p align = "justify"> After designing our DNA origami box, we started looking for a suitable "lock and key" system. With a suitable lock and key, we would be able to open a closed origami box, as shown in Fig.1. </p>
<div class="img_gal" style="width:400px;"> <div class="img_gbox"> <a rel="lightbox[aptamer_origami]" title="Front view of a closed origami box" href="http://openwetware.org/images/2/27/BM12_Nanosaurs_DNA_Origami_Closed_Aptamer_800.jpg"><img src="http://openwetware.org/images/1/17/BM12_Nanosaurs_DNA_Origami_Closed_Aptamer_250.jpg"></a> <div class="descr">Fig. 1(a) Front view of a closed origami box</div> </div> <div class="img_gbox"><a rel="lightbox[aptamer_origami]" title="Top view of an open origami box" href="http://openwetware.org/images/b/b5/BM12_Nanosaurs_DNA_Origami_Open_Aptamer_800.jpg"><img style="height:130px" src="http://openwetware.org/images/8/86/BM12_Nanosaurs_DNA_Origami_Open_Aptamer_250.jpg"></a> <div class="descr">Fig. 1(b) Box opens when the key binds to the lock. Top view of an open origami box</div> </div> <div class="descr" align = "center">Fig. 1 When the lock and key interact, the origami box opens.</div> </div>
<div class="clear"></div>
<p align = "justify">
For our purposes, we adapted the lock and key system based on the specific binding of PDGF (Platelet Derived Growth Factor) to an aptamer strand.
Such a system has been successfully used for a similar application (Douglas et al., Science Vol 335 17 February 2012,831-834). Aptamers are
artificial specific oligonucleotides, DNA or RNA, with the ability to bind to non-nucleic acid target molecules, such as peptides, proteins, drugs, organic and inorganic molecules or even whole cells, with high affinity and specificity (Mairal et al., Anal Bioanal Chem (2008) 390:989–1007).
PDGF is one of the numerous proteins regulating cell growth and division. It is considered a potent activator for the cell types essential for
tissue repair and wound healing(GF. Pierce et al., Biochem 1991 Apr;45(4):319-26). In our system, we used a PDGF-specific aptamer based locking system, as described by Douglas et al..
Each lock is essentially composed of two complementary oligonuleotidic strands - an aptamer strand specific to PDGF and a strand complementary to it.</p>
<p><big><b>Aptamer strand: <code class="dna_blue">5'TACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA3'</code></b></big></p>
<p><big><b>Aptamer locking strand: <code class="dna_green">3'ATGAGTCCCGACACGTTCGTTAACACCAGGGTTACCCGACTCAT5'</code></b></big></p>
</div> <div id="tabs-2"> </div> <div id="tabs-3"> <p align = "justify">To confer specificity to the opening of our DNA Origami Box, we wanted to use an aptamer based lock and key system. The specificity of aptamer-protein binding reactions, opens up numerous possibilities for using the system in biological scenarios. Our lock and key mechanism was adapted from previously established results. However, the system did not work as well as expected. It was hard to ascertain that the lock was definitely open. Multiple spectroscopic measurements were run with different parametric conditions and different lock and key concentrations. The end result was however, not successful. To rule out the possibility of hinderances in aptamer-protein binding due to the presence of the fluorophores, gel shift assays were run. It was seen that the presence of the fluorophores did not show results different from when fluorophores were present. To confirm the specificity of PDGF to the aptamer, gel shift assays were run. It was observed that PDGF bound to the unspecific sequences too. Overall, the system did not perform as expected. However, the use of blockers to open the lock was our temporary fix to the problem.</p> </div> </div> </body> </html>