Biomod/2012/TU Dresden/Nanosaurs/Project/Aptamer lock: Difference between revisions

Revision as of 20:53, 27 October 2012

<html>  <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-1.8.2.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-ui-1.9.1.custom.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.smooth-scroll.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/lightbox.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.queryloader2.js"></script>  <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/superfish.js"></script>  <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.hoverIntent.minified.js"></script>  <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.scrollTo-1.4.3.1-min.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.localscroll-1.2.7-min.js"></script>  <link href='http://fonts.googleapis.com/css?family=Merriweather:400,700' rel='stylesheet' type='text/css'> <link href='http://biomod-dresden-2012.googlecode.com/svn/trunk/css/superfish.css' rel='stylesheet' type='text/css'> <link rel="stylesheet" href="http://biomod-dresden-2012.googlecode.com/svn/trunk/css/lightbox.css" type="text/css" media="screen" /> <link rel="stylesheet" href="http://code.jquery.com/ui/1.9.0/themes/base/jquery-ui.css" /> <script type"text/javascript"> // Main function that waits for the browser to be ready $(document).ready(function(){ //make css accesible, please change the alter_css to chnage the style var alter_css = $("#alter_css").html(); $("style").remove(); $('head').append('<link rel="stylesheet" href="/skins/monobook/shared.css?164" type="text/css" />'); $('head').append('<link rel="stylesheet" href="http://biomod-dresden-2012.googlecode.com/svn/trunk/nanos.css" type="text/css" />'); //additional divs $(".firstHeading").wrap('<div id="header"></div>'); $(".firstHeading").wrap('<div id="inner_header"></div>'); $(".firstHeading").wrap('<div id="title_con"></div>'); var nav = $("#nav").html(); $('#inner_header').append(nav); $('#inner_header').append('<div class="clear"></div>'); //clean up wiki framework $("#sidebar-main").remove(); $(".portlet").remove(); //fix breadcrumbs $('#contentSub').remove(); //fix heading var h1 = $(".firstHeading").text().split("/"); $(".firstHeading").text(h1[h1.length-1]); //start plugins for navigation $("ul.sf-menu").superfish({ delay: 800, // one second delay on mouseout animation: {opacity:'show',height:'show'}, // fade-in and slide-down animation speed: 'normal', // faster animation speed }); $('#main_saurs').localScroll(); $("tr:odd").addClass("odd");

}); </script>

(function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); </script> <script type="text/javascript">var addthis_config = {"data_track_addressbar":false};</script> <script type="text/javascript" src="http://s7.addthis.com/js/300/addthis_widget.js#pubid=ra-508414b242f27ceb"></script> <script id="nav"> <div id="nav"> <ul id="nav" class="sf-menu"> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs">home</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Team">team</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project">project</a> <ul> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project">overview</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project/DNA origami">dna origami</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project/Vesicles">vesicles</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project/Aptamer_lock">aptamer lock</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project/Future_work">future work</a></li> </ul> </li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Lab_book">lab book</a> <ul> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Lab_book#recipes">recipes</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Lab_book#protocols">protocols</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Lab_book#downloads">downloads</a></li> </ul> </li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Gallery">gallery</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Sponsors">sponsors</a></li> </ul> </div> </script>

</html> <html> <body>

   <link rel="stylesheet" href="http://code.jquery.com/ui/1.9.0/themes/base/jquery-ui.css" />

<ul> <li><a href="#tabs-1">Lock and Key</a></li> <li><a href="#tabs-2">Experimental Methods </a></li> <li><a href="#tabs-3">Challenges Faced</a></li> </ul>

<p align = "justify"> After designing our DNA origami box, we started looking for a suitable "lock and key" system. With a suitable lock and key, we would be able to open a closed origami box, as shown in Fig.1. </p>

<div class="img_gal" style="width:400px;"> <div class="img_gbox"> <a rel="lightbox[aptamer_origami]" title="Front view of a closed origami box" href="http://openwetware.org/images/2/27/BM12_Nanosaurs_DNA_Origami_Closed_Aptamer_800.jpg"><img src="http://openwetware.org/images/1/17/BM12_Nanosaurs_DNA_Origami_Closed_Aptamer_250.jpg"></a> <div class="descr">Fig. 1(a) Front view of a closed origami box</div> </div> <div class="img_gbox"><a rel="lightbox[aptamer_origami]" title="Top view of an open origami box" href="http://openwetware.org/images/b/b5/BM12_Nanosaurs_DNA_Origami_Open_Aptamer_800.jpg"><img style="height:130px" src="http://openwetware.org/images/8/86/BM12_Nanosaurs_DNA_Origami_Open_Aptamer_250.jpg"></a> <div class="descr">Fig. 1(b) Box opens when the key binds to the lock. Top view of an open origami box</div> </div> <div class="descr" align = "center">Fig. 1 When the lock and key interact, the origami box opens.</div> </div>

<p align = "justify"> For our purposes, we adapted the lock and key system based on the specific binding of PDGF (Platelet Derived Growth Factor) to an aptamer strand. Such a system has been successfully used for a similar application (Douglas et al., Science Vol 335 17 February 2012,831-834). Aptamers are artificial specific oligonucleotides, DNA or RNA, with the ability to bind to non-nucleic acid target molecules, such as peptides, proteins, drugs, organic and inorganic molecules or even whole cells, with high affinity and specificity (Mairal et al., Anal Bioanal Chem (2008) 390:989–1007). PDGF is one of the numerous proteins regulating cell growth and division. It is considered a potent activator for the cell types essential for tissue repair and wound healing(GF. Pierce et al., Biochem 1991 Apr;45(4):319-26). In our system, we used a PDGF-specific aptamer based locking system, as described by Douglas et al.. Each lock is essentially composed of two complementary oligonuleotidic strands - an aptamer strand specific to PDGF and a strand complementary to it.</p>

<p><big><b>Aptamer strand: <code class="dna_blue">5'TACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA3'</code></b></big></p>

<p><big><b>Aptamer locking strand: <code class="dna_green">3'ATGAGTCCCGACACGTTCGTTAACACCAGGGTTACCCGACTCAT5'</code></b></big></p>

<p align = "justify">When Human PDGF-BB interacts with such a hybrid, it interacts with the Aptamer strand and the two strands of the lock dissociate. In other words, the complementary strand is displaced by PDGF because it has a higher affinity to the aptamer (K<sub>d</sub> = 0.129±0.011 nM) (Green et al., Biochemistry 1996, 35, 14413-14424). To enhance the efficiency of the system, the aptamer-locking strand is designed to be partially complementary to the aptamer strand. Such a design with shorter complementary sequences (24 bp) combined with a stretch of 16 mismatches between the two strands, increases the rate of interaction between the aptamer and PDGF. However, the lock is still stable enough when the Origami box is closed. The locks were hence designed as described in Fig. 2 (a). The two strands of the lock are attached to the the origami box by means of origami attachment sequences, complementary to the origami scaffold. In order to see how efficiently the lock and key system works we had to come up with an assay to characterize its functioning. To actualize this, Black Hole Quencher (BHQ) labeled aptamer strands and Cyanine 3 (Cy3) labeled aptamer locking strands were used to form the lock. In principle, when the DNA origami box is closed, the flouorescence of the Cy3 fluorophore is quenched due to its proximity to the BHQ (Fig. 2 (a)). In the presence of PDGF, When the box is open, the distance between the quencher and Cy3 is large enough to observe a strong Cy3 fluorescence (Fig. 2 (b)). Consequently, opening of the structure can be detected by an increase in the Cy3 fluorescence signal. </p>

</div> <div id="tabs-2"> </div> <div id="tabs-3"> <p align = "justify">To confer specificity to the opening of our DNA Origami Box, we wanted to use an aptamer based lock and key system. The specificity of aptamer-protein binding reactions, opens up numerous possibilities for using the system in biological scenarios. Our lock and key mechanism was adapted from previously established results. However, the system did not work as well as expected. It was hard to ascertain that the lock was definitely open. Multiple spectroscopic measurements were run with different parametric conditions and different lock and key concentrations. The end result was however, not successful. To rule out the possibility of hinderances in aptamer-protein binding due to the presence of the fluorophores, gel shift assays were run. It was seen that the presence of the fluorophores did not show results different from when fluorophores were present. To confirm the specificity of PDGF to the aptamer, gel shift assays were run. It was observed that PDGF bound to the unspecific sequences too. Overall, the system did not perform as expected. However, the use of blockers to open the lock was our temporary fix to the problem.</p> </div> </div> </body> </html>

Biomod/2012/TU Dresden/Nanosaurs/Project/Aptamer lock: Difference between revisions

Revision as of 20:53, 27 October 2012

Navigation menu

Page actions

Page actions

Personal tools

Navigation

Search

research

Tools

@@ Line 66: / Line 66: @@
 		<p><big><b>Aptamer locking strand:	<code class="dna_green">3'ATGAGTCCCGACACGTTCGTTAACACCAGGGTTACCCGACTCAT5'</code></b></big></p>
+<p align = "justify">When Human PDGF-BB interacts with such a hybrid, it interacts with the Aptamer strand and the two strands of the lock dissociate. In other words, the complementary
+		strand is displaced by PDGF because it has a higher affinity to the aptamer (K<sub>d</sub> = 0.129±0.011 nM) (Green et al., Biochemistry 1996, 35, 14413-14424). To enhance the efficiency of the system, the aptamer-locking strand is designed to
+		be partially complementary to the aptamer strand. Such a design with shorter complementary sequences (24 bp) combined with a stretch of 16 mismatches between the two strands, increases the rate of interaction between the aptamer and PDGF.
+		However, the lock is still stable enough when the Origami box is closed. The locks were hence designed as described in Fig. 2 (a). The two
+		strands of the lock are attached to the the origami box by means of origami attachment sequences, complementary to the origami scaffold.
+		In order to see how efficiently the lock and key system works we had to come up with an assay to characterize its functioning. To actualize this,
+		Black Hole Quencher (BHQ) labeled aptamer strands and Cyanine 3 (Cy3) labeled aptamer locking strands were used to form the lock. In principle, when the DNA origami box is closed,
+		the flouorescence of the Cy3 fluorophore is quenched due to its proximity to the BHQ (Fig. 2 (a)). In the presence of PDGF, When the box is open, the distance between the
+		quencher and Cy3 is large enough to observe a strong Cy3 fluorescence (Fig. 2 (b)). Consequently, opening of the structure can be detected by an increase in the Cy3 fluorescence signal.
+		</p>