Biomod/2012/TU Dresden/Nanosaurs/Project/Aptamer lock

From OpenWetWare
Revision as of 22:02, 27 October 2012 by Gilbert S. Canon (talk | contribs)
Jump to navigationJump to search

<html> <!--import jquery libraries--> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-1.8.2.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-ui-1.9.1.custom.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.smooth-scroll.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/lightbox.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.queryloader2.js"></script> <!-- progress preloading--> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/superfish.js"></script> <!-- menu bar--> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.hoverIntent.minified.js"></script> <!-- replaces hover for navigation--> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.scrollTo-1.4.3.1-min.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.localscroll-1.2.7-min.js"></script> <!--import webfonts--> <link href='http://fonts.googleapis.com/css?family=Merriweather:400,700' rel='stylesheet' type='text/css'> <link href='http://biomod-dresden-2012.googlecode.com/svn/trunk/css/superfish.css' rel='stylesheet' type='text/css'> <link rel="stylesheet" href="http://biomod-dresden-2012.googlecode.com/svn/trunk/css/lightbox.css" type="text/css" media="screen" /> <link rel="stylesheet" href="http://code.jquery.com/ui/1.9.0/themes/base/jquery-ui.css" /> <script type"text/javascript"> // Main function that waits for the browser to be ready $(document).ready(function(){ //make css accesible, please change the alter_css to chnage the style var alter_css = $("#alter_css").html(); $("style").remove(); $('head').append('<link rel="stylesheet" href="/skins/monobook/shared.css?164" type="text/css" />'); $('head').append('<link rel="stylesheet" href="http://biomod-dresden-2012.googlecode.com/svn/trunk/nanos.css" type="text/css" />'); //additional divs $(".firstHeading").wrap('<div id="header"></div>'); $(".firstHeading").wrap('<div id="inner_header"></div>'); $(".firstHeading").wrap('<div id="title_con"></div>'); var nav = $("#nav").html(); $('#inner_header').append(nav); $('#inner_header').append('<div class="clear"></div>'); //clean up wiki framework $("#sidebar-main").remove(); $(".portlet").remove(); //fix breadcrumbs $('#contentSub').remove(); //fix heading var h1 = $(".firstHeading").text().split("/"); $(".firstHeading").text(h1[h1.length-1]); //start plugins for navigation $("ul.sf-menu").superfish({ delay: 800, // one second delay on mouseout animation: {opacity:'show',height:'show'}, // fade-in and slide-down animation speed: 'normal', // faster animation speed }); $('#main_saurs').localScroll(); $("tr:odd").addClass("odd");

}); </script>

<script type="text/javascript"> var _gaq = _gaq || []; _gaq.push(['_setAccount', 'UA-35720700-1']); _gaq.push(['_trackPageview']);

(function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); </script> <script type="text/javascript">var addthis_config = {"data_track_addressbar":false};</script> <script type="text/javascript" src="http://s7.addthis.com/js/300/addthis_widget.js#pubid=ra-508414b242f27ceb"></script> <script id="nav"> <div id="nav"> <ul id="nav" class="sf-menu"> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs">home</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Team">team</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project">project</a> <ul> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project">overview</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project/DNA origami">dna origami</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project/Vesicles">vesicles</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project/Aptamer_lock">aptamer lock</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Project/Future_work">future work</a></li> </ul> </li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Lab_book">lab book</a> <ul> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Lab_book#recipes">recipes</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Lab_book#protocols">protocols</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Lab_book#downloads">downloads</a></li> </ul> </li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Gallery">gallery</a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Sponsors">sponsors</a></li> </ul> </div> </script>

</html>

<html> <script> $(function() { $( "#tabs" ).tabs(); }); </script>

<body> <div id="tabs" class="tabs-bottom"> <ul> <li><a href="#tabs-1">Lock and Key</a></li> <li><a href="#tabs-2">Experimental Methods </a></li> <li><a href="#tabs-3">Challenges Faced</a></li> </ul> <div class="tabs-spacer"></div> <div id="tabs-1">

<h2>Search for Locks and Keys</h2>

<p align = "justify"> After designing our DNA origami box, we started looking for a suitable "lock and key" system. With a suitable lock and key, we would be able to open a closed origami box, as shown in Fig.1. </p> <div class="img_gal" style="width:400px;"> <div class="img_gbox"> <a rel="lightbox[aptamer_origami]" title="Front view of a closed origami box" href="http://openwetware.org/images/2/27/BM12_Nanosaurs_DNA_Origami_Closed_Aptamer_800.jpg"><img src="http://openwetware.org/images/1/17/BM12_Nanosaurs_DNA_Origami_Closed_Aptamer_250.jpg"></a> <div class="descr">Fig. 1(a) Front view of a closed origami box</div> </div> <div class="img_gbox"><a rel="lightbox[aptamer_origami]" title="Top view of an open origami box" href="http://openwetware.org/images/b/b5/BM12_Nanosaurs_DNA_Origami_Open_Aptamer_800.jpg"><img style="height:130px" src="http://openwetware.org/images/8/86/BM12_Nanosaurs_DNA_Origami_Open_Aptamer_250.jpg"></a> <div class="descr">Fig. 1(b) Box opens when the key binds to the lock. Top view of an open origami box</div> </div> </div> <div class="clear"></div> <p align = "center">Fig. 1 When the lock and key interact, the origami box opens.</p>

<p align = "justify"> For our purposes, we adapted the lock and key system based on the specific binding of PDGF (Platelet Derived Growth Factor) to an aptamer strand. Such a system has been successfully used for a similar application (Douglas et al., Science Vol 335 17 February 2012,831-834). Aptamers are artificial specific oligonucleotides, DNA or RNA, with the ability to bind to non-nucleic acid target molecules, such as peptides, proteins, drugs, organic and inorganic molecules or even whole cells, with high affinity and specificity (Mairal et al., Anal Bioanal Chem (2008) 390:989–1007). PDGF is one of the numerous proteins regulating cell growth and division. It is considered a potent activator for the cell types essential for tissue repair and wound healing(GF. Pierce et al., Biochem 1991 Apr;45(4):319-26). In our system, we used a PDGF-specific aptamer based locking system, as described by Douglas et al.. Each lock is essentially composed of two complementary oligonuleotidic strands - an aptamer strand specific to PDGF and a strand complementary to it.</p>

<p><b><big>Aptamer strand: <code class="dna_blue">5'TACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA3'</code></big></b></p>

<p><b><big>Aptamer locking strand: <code class="dna_green">3'ATGAGTCCCGACACGTTCGTTAACACCAGGGTTACCCGACTCAT5'</code></b></big></p>

<p align = "justify">When Human PDGF-BB interacts with such a hybrid, it interacts with the Aptamer strand and the two strands of the lock dissociate. In other words, the complementary strand is displaced by PDGF because it has a higher affinity to the aptamer (K<sub>d</sub> = 0.129±0.011 nM) (Green et al., Biochemistry 1996, 35, 14413-14424). To enhance the efficiency of the system, the aptamer-locking strand is designed to be partially complementary to the aptamer strand. Such a design with shorter complementary sequences (24 bp) combined with a stretch of 16 mismatches between the two strands, increases the rate of interaction between the aptamer and PDGF. However, the lock is still stable enough when the Origami box is closed. The locks were hence designed as described in Fig. 2 (a). The two strands of the lock are attached to the the origami box by means of origami attachment sequences, complementary to the origami scaffold. In order to see how efficiently the lock and key system works we had to come up with an assay to characterize its functioning. To actualize this, Black Hole Quencher (BHQ) labeled aptamer strands and Cyanine 3 (Cy3) labeled aptamer locking strands were used to form the lock. In principle, when the DNA origami box is closed, the flouorescence of the Cy3 fluorophore is quenched due to its proximity to the BHQ (Fig. 2 (a)). In the presence of PDGF, When the box is open, the distance between the quencher and Cy3 is large enough to observe a strong Cy3 fluorescence (Fig. 2 (b)). Consequently, opening of the structure can be detected by an increase in the Cy3 fluorescence signal. </p> <div class="img_gal"> <div class="img_gbox"> <a rel="lightbox[aptamer_lock]" title="Labeled aptamer lock" href="http://openwetware.org/images/b/bd/BM12_Nanosaurs_Aptamer_lock_800.jpg"><img src="http://openwetware.org/images/1/10/BM12_Nanosaurs_Aptamer_lock_250.jpg"></a> <div class="descr">(a) Labeled aptamer lock</div> </div> <div class="img_gbox"><a rel="lightbox[aptamer_lock]" title="The lock opens when PDGF binds" href="http://openwetware.org/images/5/52/BM12_Nanosaurs_Aptamer_lock_PDGF_800.jpg"><img src="http://openwetware.org/images/d/de/BM12_Nanosaurs_Aptamer_lock_PDGF_250.jpg"></a> <div class="descr">(b) The lock opens when PDGF binds</div> </div> <div class="img_gbox"><a rel="lightbox[aptamer_lock]" title="The lock opens when PDGF binds" href="http://openwetware.org/images/5/52/BM12_Nanosaurs_Aptamer_lock_PDGF_800.jpg"><img src="http://openwetware.org/images/d/de/BM12_Nanosaurs_Aptamer_lock_PDGF_250.jpg"></a> <div class="descr">(b) The lock opens when PDGF binds</div> </div> </div>

<div class="clear"></div> <p align = "center">Fig. 1 When the lock and key interact, the origami box opens.</p>

</div> <div class="tabs-spacer"></div> <div id="tabs-2"> <h2>Spectrophotometric Measurements</h2>

<p align = "justify"> In all our experiments, the lock was a hybrid of the complete aptamer strand and the complete aptamer locking strand, as described in Fig. 2 (a). These strands will heneceforth be refered to as the aptamer strand and the aptamer locking strand respectively. Unless otherwise specified, the mention of a "lock" refers to a hydrid of the complete aptamer and aptamer locking strands, labeled with BHQ and Cy3 respectively. All the samples were prepared as described under <a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/Lab_book#protocols">(Lab Book -> Protocols)</a>.</p>

<div class="img_right"> <a rel="lightbox[aptamer_fluoro]" title="Linear increase in fluorescence with increase in Cy3 labeled lock concentration" href="http://openwetware.org/images/1/1f/BM12_Nanosaurs_Aptamer_Fluorescence_Graph800.jpg"><img src="http://openwetware.org/images/7/7d/BM12_Nanosaurs_Aptamer_Fluorescence_Graph_250.jpg"></a> <div class="descr" align = "center">Fig. 3 Linear increase in fluorescence with increase in Cy3 labeled lock concentration. BHQ was absent</div> </div>

<p>To begin with, the experiments for characterization of the lock were performed independent of the origami. In these experiments, the aptamer strand of the lock was not labeled with BHQ.

          Only the aptamer locking strand was labeled with Cy3. </p><p>We performed experiments to obtain an optimal fluorophore (Cy3) labeled lock concentration with an optimal signal-to-noise ratio. In all such measurements, 

samples containing the fluorophore were excited at 510 nm and emission was recorded at 564 nm, using a spectrophotometer. Fluorescence was measured for 1 nM, 10 nM and 100 nM Cy3 labeled lock concentrations. It was observed that the intensity of fluorescence increased linearly with the concentration (Fig. 3). A 10 nM Cy3 labeled lock concentration proved optimal, based on the fluorescence spectra obtained. </p> <div class="clear"></div>

<div class="img_left"> <a rel="lightbox[aptamer_fluoro]" title="Fluorescence measurements with closed lock" href="http://openwetware.org/images/d/d6/BM12_Nanosaurs_Fluorescence2_800.jpg"><img src="http://openwetware.org/images/7/70/BM12_Nanosaurs_Fluorescence2_250.jpg"></a> <div class="descr" align = "center">Fig. 5 Fluorescence measurements with closed lock</div> </div> <p align = "justify">Solutions with 10 nM lock concentrations were measured for fluorescence. A control experiment was also designed, in which the aptamer strand of the lock hybrid was unlabeled. In such a control, since the Cy3 fluorescence from the fluorophore on the aptamer locking strand, does not get quenched, a high fluorescence was obtained. In comparison, the lock hybrid with both labels, showed a considerably lower fluorescence signal (Fig. 5a). Hence, it was clear that the closed state of the lock is clearly discernible.</p> <div class="clear"></div>

<p align = "justify">We now had the lock and had to work on opening it with its key. Samples of the lock were incubated with PDGF for 24 Hrs <sup>[1]</sup>. PDGF was always used in a 10 times excess concentration than that of the lock. Control experiments were also designed. The negative control, consisted of the lock. Hence, very minimal signal would be expected with such a control. The positive control sample had the lock with only the aptamer locking strand labeled. In such a control, since the quencher is absent, a high flouorescence signal would be expected. However, even after repeated trials, no significant increase in fluorescenec intensity was observed in the presence of PDGF (Fig. 5b). </p> <div class="clear"></div>


<p> Since, the use of PDGF to open the lock hybrid did not seem to work, the question remained; Why did the PDGF key not open the aptamer lock?</p>

          <p>- What would you do if you cannot open a lock with your key?</p>
          <p>- You would probably try another key! </p>

<p align = "justify">That is exactly what we did. We used two oligonucleotidic single strands, with sequences complementary to the aptamer strand and the aptamer locking strand, which we call blockers (Fig. 6). Blocker 1 and blocker 2 are complementary to the aptamer strand and the aptamer locking strand respectively. One may consider blockers as better keys because their interaction with the lock is guaranteed due to their sequence complementarity.</p>

<div class="img_gal"> <div class="img_gbox"> <a rel="lightbox[aptamer_lock]" title="Use of blocker 1 complementary to the aptamer strand, opens the lock" href="http://openwetware.org/images/b/bd/BM12_Nanosaurs_Aptamer_lock_800.jpg"><img src="http://openwetware.org/images/1/10/BM12_Nanosaurs_Aptamer_lock_250.jpg"></a> <div class="descr">(a) Use of blocker 1 complementary to the aptamer strand, opens the lock</div> </div> <div class="img_gbox"><a rel="lightbox[aptamer_lock]" title="Use of blocker 2 complementary to the aptamer locking strand, opens the lock" href="http://openwetware.org/images/5/52/BM12_Nanosaurs_Aptamer_lock_PDGF_800.jpg"><img src="http://openwetware.org/images/d/de/BM12_Nanosaurs_Aptamer_lock_PDGF_250.jpg"></a> <div class="descr">(b) Use of blocker 2, complementary to the aptamer locking strand, opens the lock</div> </div> <div class="img_gbox"><a rel="lightbox[aptamer_lock]" title="The lock opens when PDGF binds" href="http://openwetware.org/images/5/52/BM12_Nanosaurs_Aptamer_lock_PDGF_800.jpg"><img src="http://openwetware.org/images/d/de/BM12_Nanosaurs_Aptamer_lock_PDGF_250.jpg"></a> <div class="descr">(b) The lock opens when PDGF binds</div> </div> </div>

<div class="clear"></div>

<p align = "center">Fig. 1 When the lock and key interact, the origami box opens.</p>

<p align = "justify">Experiments were hence also designed, including the blockers. The following samples were prepared, to serve as the experiments and the controls. <div class="clear"></div> <div class="img_right img_link"> <a rel="lightbox" href="http://www.openwetware.org/images/9/95/BM12_nanosaurs_lsamples_%28Custom%29.png"><img src= "http://www.openwetware.org/images/e/eb/BM12_nanosaurs_lsamples_s.png" ></a> <div class="descr">Fig 7. Fluorescence measurements to study lock function</div> </div>

<p>Samples</p> <ol> <li>Lock</li> <li>Lock - aptamer strand without BHQ, aptamer locking strand without Cy3</li> <li>Lock - aptamer strand without BHQ, aptamer locking strand without Cy3; with PDGF </li> <li>Lock; with PDGF</li> <li>Lock; with blocker 1</li> <li>Lock; with blocker 2</li> <li>Lock; with both blockers, blocker1:blocker2 = 10:1</li> <li>Lock; with both blockers, blocker2:blocker1 = 10:1</li> <li>Lock; with both blockers, blocker1:blocker2 = 10:1, sample annealed before incubation</li> <li>Lock; with both blockers, blocker2:blocker1 = 10:1, sample annealed before incubation</li> </ol>


<p align = "justify">PDGF was always used in a 10 times excess concentration than that of the lock. All the samples were incubated at room temperature for 24 Hrs. The results of this experiment are presented in Fig. 7 below.</p>

<p> From the results obtained, it was observed hat the blockers work better than PDGF at opening the lock hybrid. Blocker 1 was found to be more efficient than blocker 2 as expected, since Blocker 1 is complementary to the aptamer strand over a longer length than Blocker 2 to the aptamer locking strand.

<h2>Gel Shift Assays</h2> <p align = "justify">Our lock and key system was adapted from previously published results <sup>[1]</sup>, the only variable being that both the aptamer strand and the strand complementary to the aptamer were labeled. Hence, when our spectrophotometric measurements did not give us affirmative results, our first concern was whether the presence of the fluorophores was causing steric hinderences that prevented the key from binding to the lock. To clarify this concern, we ran a gel shift experiment (Fig. 8). The samples for each lane of the gel are as described below.</p>


<div class="clear"></div> <div style="float:right;width:300px;padding: 10px;"> <p>Lanes:</p> <ol> <li>Lock</li> <li>Lock; PDGF</li> <li>Aptamer strand with BHQ</li> <li>Aptamer strand with BHQ; with PDGF</li> <li>Aptamer locking strand with Cy3</li> <li>Ladder</li> <li>Lock - aptamer strand without BHQ, aptamer locking strand without Cy3</li> <li>Lock - aptamer strand without BHQ, aptamer locking strand without Cy3; PDGF</li> <li>Aptamer strand without BHQ</li> <li>10. Aptamer strand without BHQ; PDGF</li> </ol> </div>

<div class="img_left img_link"> <a rel="lightbox" href=" "><img src= " " ></a> <div class="descr">Figure 8.Gel shift assay with labeled and unlabeled locks</div> </div> <div class="clear"></div>







<p>The correct ratios and the recipe of the folding buffer can be found in the recipe section.

          <br>Following a detailed protocol the mixture is heated up to 85°C and then cooled down very 

slowly using a given temperature ramp. Especially in the area of 55°C the cooling process is extremely slow since most of the assembly process happens in that temperature region. The whole cooling process takes about 15 hours.<br>After the assembly the structures remain stable at room temperature.

       </p>

<h3>Purification</h3>

<p>To have a greater yield of assembled structures, the ratio of staple strands to scaffold strands is 7.5 to 1. To get rid of the leftover single strands after assembly, the samples are typically dialyzed for 1 to 2 hours using a 0.025µm filter. </p>

<h2>Results</h2>

<p>In order to examine the shape of the structure, the samples were imaged using transmission electron (TEM) and atomic force microscopy (AFM). </p>

<h3>TEM</h3>

<p>To image the structures via transmission electron microscopy the samples were stained with uranyl acetate (see <a href="http://openwetware.org/wiki/Biomod/2012/TU_Dresden/Nanosaurs/ Lab_book">protocols</a>). </p>

<div class="img_set"> <a rel="lightbox[origami]" title="TEM overview & close-up of open structures" href="http://openwetware.org/images/a/a8/BM12_nanosaurs_TEMOpen.jpg"><img src="http://openwetware.org/images/4/40/BM12_nanosaurs_TEMOpen_s.jpg"></a> <a rel="lightbox[origami]" title="TEM overview & close-up of closed lying structures" href="http://openwetware.org/images/7/7b/BM12_nanosaurs_TEMClosed.jpg"><img src="http://openwetware.org/images/d/d2/BM12_nanosaurs_TEMClosed_s.jpg"></a> <a rel="lightbox[origami]" title="TEM overview & close-up of closed upright standing structures" href="http://openwetware.org/images/f/ff/BM12_nanosaurs_TEMUpright.jpg"><img src="http://openwetware.org/images/b/b3/BM12_nanosaurs_TEMUpright_s.jpg"></a> </div>

<p>The TEM images demonstrate a successful assembly of both types of structures. In particular they show a significant difference in shape between the open and the closed structures. Open structures were typically twice as long as closed structures (see below). For these images the closed structures were assembled including the guide strands, but also the not guided constructs showed a conformational change with a high percentage of the structures being closed.

          <br/>Producing negatively stained samples (using short staining times) it was possible to image the 

closed structures standing upright. The pictures show that the shape of the cross section is rather variable. However, most of the structures show a high degree of integrity, i.e. a closed circumference supporting that the structures are really closed.<br/>Evaluating several individual structures the following average lateral dimensions of both types of DNA origami were obtained:

       </p>

<table> <tr> <th rowspan="2">&#91;nm&#93;</th> <th colspan="2">closed</th> <th>open</th> </tr> <tr> <th>width</th> <th>length</th> <th>full length</th> </tr> <tr> <td><b># of measurements</b></td> <td>26</td> <td>29</td> <td>40</td> </tr> <tr> <td><b>result (95&#37; STD)</b></td> <td>48,9 &#177; 5,9</td> <td>39,6 &#177; 3,4</td> <td>71,4 &#177; 3,8</td> </tr> <tr> <td><b>relative error &#91;&#37;&#93; </b></td> <td>12,0</td> <td>8,6</td> <td>5,3</td> </tr> <tr> <td><b>Expected</b></td> <td>45</td> <td>40-44</td> <td>80-88</td> </tr> <tr> <td><b>Possible reason</b> <br/> <b>for deviation</b></td> <td></td> <td></td> <td>Hinges and edges <br/> floppy single strands</td> </tr> </table>

<div class="img_set"> <a rel="lightbox[origami]" title="Distribution of width for closed structures" href="http://openwetware.org/images/c/c4/BM12_nanosaurs_histograms_Width_%28closed%29800.jpg"><img src="http://openwetware.org/images/b/b6/BM12_nanosaurs_histogram_Width_%28closed%29250.jpg"></a> <a rel="lightbox[origami]" title="Distribution of length for closed structures" href="http://openwetware.org/images/6/6e/BM12_nanosaurs_histograms_Length_%28closed%29800.jpg"><img src="http://openwetware.org/images/8/8d/BM12_nanosaurs_histogram_Length_%28closed%29250.jpg"></a> <a rel="lightbox[origami]" title="Distribution of full length for open structures" href="http://openwetware.org/images/4/4e/BM12_nanosaurs_histograms_Length_%28open%29800.jpg"><img src="http://openwetware.org/images/4/43/BM12_nanosaurs_histogram_Length_%28open%29250.jpg"></a> </div>

<p>For the closed structure the length, as well as the width, match nicely the expected values. The slightly higher width can be explained by assuming that the structures laying down flat which increases the lateral dimension due to the bending down of the side walls.<br>

          The open structure however appeared to be shorter than one would expect if one doubles the length

of a closed structure. This can be explained due to the fact that the turning points, as well as the hinges, were left as single strands making them more flexible. Therefore they do not necessarily have to be stretched to their full lengths. In general the open structure shows increased flexibility and degrees of freedom compared to the closed constructs.

       </p>

<h3>AFM</h3> <p>To further proof of the correct assembly, the open and closed structures were sent to the Spanish National Center for Biotechnology in Madrid. There Dr. Fernando Moreno-Herrero and Maria Eugenia Fuentes obtained a series of magnificent AFM images.The following pictures show the different samples in an overview (left) as well as an enlarged view of a single structure (right).</p>

<div style="width: 400px;" class="img_set"> <a rel="lightbox[origami]" title="AFM overview of open structures" href="http://openwetware.org/images/2/2a/BM12_nanosaurs_AFM_Open_overview.jpg"><img src="http://openwetware.org/images/b/ba/BM12_nanosaurs_AFM_Open_overview_s.jpg""></a> <a rel="lightbox[origami]" title="AFM close-up of an open structure" href="http://openwetware.org/images/6/63/BM12_nanosaurs_AFM_Open_single.jpg"><img src="http://openwetware.org/images/c/c5/BM12_nanosaurs_AFM_Open_single_s.jpg"></a> <a rel="lightbox[origami]" title="AFM overview of closed structures" href="http://openwetware.org/images/5/54/BM12_nanosaurs_AFM_Closed_overview.jpg"><img src="http://openwetware.org/images/a/aa/BM12_nanosaurs_AFM_Closed_overview_s.jpg"></a> <a rel="lightbox[origami]" title="AFM close-up of a closed structure" href="http://openwetware.org/images/6/67/BM12_nanosaurs_AFM_Closed_single.jpg"><img src="http://openwetware.org/images/d/d4/BM12_nanosaurs_AFM_Closed_single_s.jpg"></a> </div> <div class="img_right img_link"> <a rel="lightbox[origami]" title="Developed blob model" href="http://openwetware.org/images/3/3e/BM12_nanosaurs_AFM_Blob_model800.jpg"><img src="http://openwetware.org/images/1/19/BM12_nanosaurs_AFM_Blob_model800_s.jpg"></a> </div>

<p>The open structures appear very homogeneous in shape, whereas a rather large degree of heterogeneity was found in the AFM images for the closed structures. A possible explanation for the less defined shape of the closed structures could be that those samples have been purified via Freeze ‘N Squeeze DNA Gel Extraction whereas the open samples have just been dialyzed. However, the Freeze’N squeeze purification gives less background, which means the sample is purer. Since the structures appear to be very fragile, the dialysis is a more suitable purification method to leave the structures intact.

          <br>Further measurements on seemingly intact closed structures provided three major classes of different

shapes. These can be interpreted by the following model developed by Dr. Fernando Moreno-Herrero and Maria Eugenia Fuentes:

       </p>

<p>The evaluations of the lateral dimensions of the origami structures in the AFM images are depicted in the table below: </p>

<table> <tr> <th colspan="2">&#91;nm&#93;</th> <th> width</th> <th> length</th> <th> height <br/> peaks</th> <th> height <br/> valleys</th> </tr> <tr> <td><b>open</b></td> <td><b>one half</b></td> <td>54,7 &#177; 3,9</td> <td>41,5 &#177; 3,2</td> <td>3,8 &#177; 0,4</td> <td>1,2 &#177; 0,3</td> </tr> <tr> <td rowspan="3"><b>closed</b></td> <td><b>2 blobs</b></td> <td>79,2 &#177; 3,4</td> <td>57,3 &#177; 5,3</td> <td>8,9 &#177; 1,7</td> <td>---</td> </tr> <tr> <td><b>3 blobs</b></td> <td>85,8 &#177; 6,7</td> <td>69,2 &#177; 5,6</td> <td>8,5 &#177; 1,8</td> <td>---</td> </tr> <tr> <td><b>4 blobs</b></td> <td>90,5 &#177; 1,2</td> <td>59,9 &#177; 6,0</td> <td>7,3 &#177; 1,6</td> <td>---</td> </tr> <tr> <td><b>Expected</b></td> <td></td> <td>45</td> <td>40-44</td> <td>10 / 20</td> <td></td> </tr> </table>

<p>The length of the open structure matches very well with the expectations. The width is slightly too large and the height is too low. This can be explained by the fact that the fragile structure preferably lays down flat on the surface and also gets pushed down by the AFM tip.<br>The increase of width and length for the closed structure can be explained by an increased tip convolution due to the increased height of the structure. However the height matches very well, since it is twice the height of the open structure indicating that the desired conformational change has been successfully achieved.<br> The various heights of the close structure also go along very well with the model of the different positions of the hexagonal DNA multifilaments.<br>In total the AFM and the TEM images confirm a successful DNA origami assembly and the expected change in conformation between open and closed structures for the majority of the objects. Also the dimensions are well in agreement with the expectations taking into account some explainable deviations due to the flexibility of the structure and the limitations of the method that was applied.

          </p>


</div> <div class="tabs-spacer"></div> <div id="tabs-3"> <h2>Gel shift assays</h2>

<p>In order to test the specific binding of cargo to our structures and calibrate the sample conditions, several gel shift assays were performed. The most relevant ones are highlighted in this section.<br>For internal controls two different schemes for cargo attachment were followed: Loading the cargo based on streptavidin-biotin interaction and employing DNA strand hybridization. In these experiments we used streptavidin coated quantum dots which can be attached to the origami in two ways:

       </p>


<ul> <li>Directly binding to internal 5’ biotinylated strands.</li> <li>Binding of the quantum dots to 3’ biotinylated oligonucleotides which can then hybridize to the internal catcher strands of the origami.</li> </ul>

<p> To make the gels easy to understand, we use the following conventions for defining which components were loaded in each lane: </p>

<div style="margin:auto; width:250px; box-shadow: 0 0 10px #888888; border: 5px solid white;"> <a rel="lightbox[origami]" title="Convention chart for gel images" href="http://openwetware.org/images/a/aa/BM12_Nanosaurs_Convention_Chart.jpg"><img src="http://openwetware.org/images/4/46/BM12_Nanosaurs_Convention_Chart_s.jpg"><div>Fig.1 Convention chart for gel images</div> </a> </div> <div class="clear"></div>


<h3>Buffer calibration</h3>

<div class="img_right img_link"> <a rel="lightbox[origami]" title="Buffer calibration" href="http://openwetware.org/images/1/1a/BM12_Nanosaurs_ImageGel2.jpg"><img src="http://openwetware.org/images/2/27/BM12_Nanosaurs_ImageGel2_s.jpg"><div>Fig.2 Buffer Calibration</div></a> </div>

<p>In order to enhance the quality of the assemblies, the effect of the folding buffer on the yield and structural integrity of the origami was examined. Four different buffers with various MgCl2 concentrations (8mM, 10mM, 12mM, 14mM) were used for assembling open and closed structures, as can be seen in Fig.2. From the pictures obtained, one can see that by increasing the MgCl2 concentration, the band for the closed structure blurs and shifts up. This indicates that the structure becomes less homogeneous and possibly the structures are also more prone to dimerization. Based on this, we took 8mM as our standard buffer for further experiments. </p>


<div class="clear"></div> <h3>Structure overview</h3>

<div class="img_left img_link"> <a rel="lightbox[origami]" title="Structure overview" href="http://openwetware.org/images/f/fd/BM12_Nanosaurs_ImageGel1.jpg"><img src="http://openwetware.org/images/1/10/BM12_nanosaurs_ImageGel1_100_s.jpg"><div>Fig.3 Structure overview</div></a> </div>

<p>At first, the quality of the basic open and closed assemblies was tested. As shown in lanes 2 and 3 (Fig.3), both assembled structures have a different structure and therefore run differently on the gel compared to the scaffold. Moreover, it can be seen that in lane number 2 there is a second band above the expected band for the structure. This likely shows that the open structures tend to aggregate more than the closed structures, which can be attributed to two main factors; MgCl2 induced stacking interactions and hybridization between the free locks of adjacent structures. </p>


<div class="clear"></div> <h3>Quantum dot binding</h3>

<div class="img_right img_link"> <a rel="lightbox[origami]" title="Quantum dot binding" href="http://openwetware.org/images/6/61/BM12_Nanosaurs_ImageGel3.jpg"><img src="http://openwetware.org/images/9/98/BM12_Nanosaurs_ImageGel3_s.jpg"><div>Fig.4 Quantum dot binding</div></a> </div>

<p>After confirming the assembly quality of our structures, cargo attachment tests were performed. In particular, we employed attachment through hybridization (Fig.4). Quantum dot cargos that carried oligomers complementary to the catcher strands of the origamis were added to the open and closed structures. Subsequently binding preferences were determined.<br>

               From the results obtained (Fig.4) one can identify a clear gel shift due to quantum dots binding in lanes 2 and 5. However, 

there’s not a noticeable difference between the open and closed configurations as the ratio of bound vs. unbound structures cannot be determined straight forward. In order to have a better idea about binding preference and to discard problems with the structure, a further experiment involving the catchers of the system was proposed. </p>


<p> </p> <div class="clear"></div> <h3>Catcher influence on binding</h3>

<div class="img_left img_link"> <a rel="lightbox[origami]" title="Catcher influence on binding" href="http://openwetware.org/images/8/8a/BM12_Nanosaurs_ImageGel4.jpg"><img src="http://openwetware.org/images/a/af/BM12_Nanosaurs_ImageGel4_s.jpg"><div>Fig.5 Catcher influence on binding</div></a> </div>

<p>The previous results showed that there was still considerable binding to the closed structures. This might be due to the catcher strands sticking out on the wrong side of the structure. Therefore, in addition to the construct with all 6 catchers to two other versions containing only one catcher were tested for cargo binding. One of them contained a single 5’ biotinylated oligo and the other contained only a single catcher for hybridization mediated binding. </p>

<p>The results shown in fig.5 suggest a preference for the binding to the open structures compared to the closed structures when only a single catcher strand was present. If six catchers are used this difference was greatly reduced. </p>

<p>To further support this, we quantified the binding preference of the structures from the gel image based on the relative intensities of the bands which showed a shift due to quantum dot binding and of the bands that contained the origami only. The obtained results are shown in the table below. </p> <div class="clear"></div> <table> <tr> <th>Lane</th> <th>Construct</th> <th>Shifted<br/>band</th> <th>Construct<br/>band</th> <th>Ratio<br/>shifted/construct</th> <th>QD affinity ratio<br/>open/closed</th> </tr> <tr> <td>4</td> <td>Open 1C</td> <td>1942</td> <td>5580</td> <td>0.35</td> <td rowspan="2">1.61</td> </tr> <tr> <td>11</td> <td>Closed 1C</td> <td>672</td> <td>3111</td> <td>0.22</td> </tr> <tr> <td>6</td> <td>Open 1C5'</td> <td>5216</td> <td>4025</td> <td>1.30</td> <td rowspan="2">1.70</td> </tr> <tr> <td>13</td> <td>Closed 1C5'</td> <td>2617</td> <td>3437</td> <td>0.76</td> </tr> <tr> <td>8</td> <td>Open 6C</td> <td>2937</td> <td>2944</td> <td>1.00</td> <td rowspan="2">1.24</td> </tr> <tr> <td>15</td> <td>Closed 6C</td> <td>4106</td> <td>5123</td> <td>0.80</td> </tr> </table>

<p> From these data, it can be seen that: </p>

<ul> <li>The quantum dots have a binding preference for the open structures over the closed ones.</li> <li>This preference decreases if the number of catchers is increased.</li> <li>The attachment performance through hybridization or biotin-streptavidin interaction is comparable.</li> </ul>

<p>However, in all cases closed structures still bind the cargos to a significant extend. The reason for this unexpected behavior still need to be explored. It may be that still to many misfolded closed origami structures are formed during assembly. This could be improved by a more careful adjustment of the annealing conditions. </p>

</div> <div class="tabs-spacer"></div>

</body> </html>