Biomod/2012/Tianjin/Protocol
From OpenWetWare
Contents |
Oligonucleotides synthesis
The logic gate
- Logic gate 1
- The logic gate:
- 5’-AGCTTCTTTCTAATACGGCTTACCTCCGAGCCGGTCGAAATAGTGCGGGTAAGCCTGGGCCTCTT
TCTTTTTAAGAAAGAAC-3’
- 5’-AGCTTCTTTCTAATACGGCTTACCTCCGAGCCGGTCGAAATAGTGCGGGTAAGCCTGGGCCTCTT
- The substrate:
- 5’-CGCACTATrAGGGTAA-3’
- The logic gate:
- Logic gate 2-1:
- The logic gate:
- Part 1: 5’- CAGGCTTACTCCGAGCCGGTCGAAATAGTGAGCGAT -3’
- Part 2: 5’- ATCGCTCACTATrAGGTAAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC -3’
- The substrate:
- 5’-AGCTTCTTTCTAATACGGCTTACC-3’
- The logic gate:
- Logic gate 2-1:
- The logic gate:
- Part1: 5’-CTCACTATrAGGAAGGGTAAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC-3’
- Part2: 5’-TTACCCTTCTCCGAGCCGGTCGAAATAGTGAG-3’
- The substrate:
- 5’-AGCTTCTTTCTAATACGGCTTACC-3’
- The logic gate:
The Y-DNA
- The improved logic gate:
- 5’-AGCTTCTTTCTAATACGGCTATGAATTCTTACTCCGAGCCGGTCGAATTGCGTTTTCGCTTGT
AAGAATTCATAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC-3’
- 5’-AGCTTCTTTCTAATACGGCTATGAATTCTTACTCCGAGCCGGTCGAATTGCGTTTTCGCTTGT
- The self-cleaved logic gate:
- 5’-CTATGAATTCTTACTCCGAGCCGGTCGAATTGCGTTTTCGCTTGTAAGAATTCATAGCCTGGG
CCTCTTTCTTTTTAAGAAAGAAC-3’
- 5’-CTATGAATTCTTACTCCGAGCCGGTCGAATTGCGTTTTCGCTTGTAAGAATTCATAGCCTGGG
- Y2:
- TATGAATTCCGAGTAGGTACAACGCAAAGGTAAGAATTCATA
- Y3:
- CTATGAATTCTTACAAGCGAAGTACCTACTCGGAATTCATA
AFM
- Turn on the power
- Turn on the computer and the display
- Turn on the control center
- Turn on the laser of the HEB (Head Electronic Box)
- Turn on MAC Mode or AC Mode Controller
- Open PicoView or Picoscan
- Select suitable imaging mode → STM, AFM, AC AFM, MAC and TopMac according to the sample
- Select suitable scanner head (100μm and 10μm) in the control software based on the sample
- Take out the scanner head, and mount to the scanner base (WITH CARE!)
- Select suitable nose according to imaging mode
- Install the nose on the scanner with vertical force of two hands together
- Use the Spring Key to open the spring, and using the tweezers to put pinpoint to the nose
- Install the scanner head, plug in, fasten the screws
- Use the two screw nuts on the scanner head to adjust the position of the laser, making the laser pointing to the back of the pinpoint
- When installing sample, make sure there is enough distance between the sample and the pinpoint. Use the Close button to get closer to the sample
- Install the detector, and adjust the screws, making deflection and LFM parameters fits the requirement
- Software setup: I, P, set point, scan speed, can size, stop at, data points per etc.
- Click Approach, the pinpoint starts to approach the sample
- Click Scan, it starts imaging. Adjusting Rotate, I, P, speed etc. in real time to achieve high quality image
Agarose electrophoresis
- 0.2g agarose mixed with 20ml 1X TAE, heat to boil
- When temperature drops, add 0.1μL golden view, cooling for 30min
- Adding 1X TAE into
- Mix 2μL 6X loading buffer with 5μL DNA sample, add 7μL of the sample into the well
- Start the electrophoresis at 150-250V, for 10-30min, depending on the blue band of loading buffer
- Stop the electrophoresis, put the gel into UV gel imager, expose for 80ms
PAGE
Nucleic acid electrophoresis utilizes the same concepts as protein electrophoresis. The denaturant and visualization techniques differ. All nucleic acids are negatively charged. It is not neccessary or desirable to use a charged denaturant such as SDS. Urea is used to denature the DNA or RNA within the gel. Visualization is usually achieved via staining with ethidium bromide. Ethidium bromide intercalates between base pairs and fluoresces. The fluoresence of free (non-bound) ethidium bromide is quenched. Note that ethidium bromide is a carcinogen and that UV light can damage skin and eyes. Gloves and protective eyeware should be used. The UV box has special anti-UV plastic and a safety interlock. Do not try to defeat the interlock.
Materials
Glass plates (10 x 20 cm), spacers, comb, and clamps
Power supply
Nucleic Acid samples
6.66 mL 30% Acrylamide
3.34 mL 5X TBE
8.41 g Urea
The TA will have prepared the solution above before lab starts. The solution must be heated to dissolve the urea. However warm gel solutions polymerize quickly with unpredictable results, so the solution must be allowed to cool before use.
140 microliters 10% Ammonium Persulfate
7 microliters TEMED
Loading buffer- 2X Dye- 0.25% Bromophenol Blue, 0.25% Xylene Cyanol
Gel Red
1X TBE for Running Buffer
Methods
Very similar to SDS PAGE gel. You should be able to assemble gel by yourself. Have the TA inspect gel prior to use.
Add 8 microliters of the Loading Buffer to 10 microliters of your nucleic acid sample
Load onto gel, and separate your nucleic acid fragments by electrophoresis at around 30 Amps, until the dye front approaches the bottom of gel. Do NOT let dye front run off gel.
Stain with Gel Red for 20 minutes. Visualize on the UV box. Caution: Wear safety glasses around UV light.
Photograph the gel. Do not dispose of the gel until you have ensured that you have a reasonable photograph.
PCR Annealing Procedure (for Logic Gate)
- 90℃ for 5 min;
- 90℃ for 1min;-1℃ per cycle
- Go to 2 for 86 times
- 4℃ forever
Recipe
- DNAzyme Buffer
1M NaCl, 30mM HEPES, pH=7.0
- TBE
10x TBE (1 liter): Dissolve 108 g Tris and 55 g Boric acid in 900 ml distilled water. Add 40 ml 0.5 M Na2EDTA (pH 8.0) (alternatively use 9.3 g Na2EDTA) Adjust volume to 1 Liter. Store at room temperature. Note: 10x TBE may take some time to dissolve, even with fast stirring TBE can be diluted to 1X prior to use in electrophoresis, 0.5x is acceptable as well.
- TAE
TAE buffer is commonly prepared as a 50X stock solution for laboratory use. A 50X stock solution can be prepared by dissolving 242g Tris base in water, adding 57.1mL glacial acetic acid, and 100mL of 500mM EDTA (pH 8.0) solution, and bringing the final volume up to 1 liter. This stock solution can be diluted 50:1 with water to make a 1X working solution. This 1X solution will contain 40mM Tris, 20mM acetic acid, and 1mM EDTA.
- Urea Loading Buffer
8 M urea, 50 mM EDTA, 0.05% xylene cyanol, and 50 mM Tris acetate, pH 8.2.




