Biomod/2012/Titech/Nano-Jugglers/Methods/DNA Design: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
 
(14 intermediate revisions by the same user not shown)
Line 3: Line 3:




=DNA Design=
==0.2. Design of linker DNA strands==
:&nbsp;&nbsp;&nbsp;&nbsp;We used DNA strands for bonding between a body of Biomolecular Rocket and platinum particles. DNA strands must be designed 4 DNA strands to hybridize at room temperature stably. DNA strands are categorized into two types, one type was a DNA strand for conjugation to polystyrene surface and its cDNA, and another type was a DNA strand for conjugation to gold surface and its cDNA. Each cDNA conjugated to platinum particles.<br>
:&nbsp;&nbsp;&nbsp;&nbsp;In this section, we explain how we design DNA strands. There are three steps to design DNA strands, first step is selection of DNA strands , second step is adjustment of the number of bases and final step is design of cDNA strand. We used NUPACK<sup>[1]</sup> for these processes of DNA design. NUPACK is a software for the analysis and design of nucleic acid systems.<br>


==Methods of Design==
:&nbsp;&nbsp;&nbsp;&nbsp;First, we chosed DNA strands from a treatise<sup>[2]</sup>. In this step,  we analyzed whether DNA could easily hybridize at room temperature stably. Then we selected two DNA strands. Secondly, we adjusted number of bases in order to make DNA easily dissociated when they introduced photo-switching systems. Finally, we design complementary DNA of each DNA strands, and modify amino group and thiol group as necessary. <br>
 
:Reference
::&nbsp;&nbsp;&nbsp;&nbsp;We designed five DNA strands. DNA strands relate to "amino modified DNA and polystyrene conjugation". One DNA strand is modified amino group to conjugate polystyrene-beads. The other one is a complementary strand, which is modified thiol group to conjugate platinum. Another DNA strand also is a complementary strand, which is modified FAM. On the other hand, Two DNA strands relate "SAM".One DNA strand includes azobenzene to photo-control. Another DNA is a complementary strand, which is modified thiol group to conjugate gold. We designed these DNA strands using NUPACK*1. And we selected orthonormal sequence, referring to a paper*2. When we designed DNA strands, we fixed the temperature at 25.0℃ and the Na+ concentration at 0.195M. And we selected DNA strands, which didn't form secondary structure.  
:&nbsp;&nbsp;&nbsp;&nbsp;[1] NUPACK nucleic acid package. http://www.nupack.org/<br>
 
:&nbsp;&nbsp;&nbsp;&nbsp;[2] Tetsuro Kitajima, Masahiro Takinoue, Ko-ichiroh Shohda, Akira Suyama. LNCS 4848, 119-129 (2008)<br>
::&nbsp;&nbsp;&nbsp;&nbsp;1) NUPACK nucleic acid package. http://www.nupack.org/
::::::::::>>back to [[Biomod/2012/Titech/Nano-Jugglers/Results#0.2._Design_of_linker_DNA_strands|Results]]
::&nbsp;&nbsp;&nbsp;&nbsp;2) Tetsuro Kitajima, Masahiro Takinoue, Ko-ichiroh Shohda, and Akira Suyama.
::&nbsp;&nbsp;&nbsp;&nbsp;Design of Code Words for DNA Computers and Nanostructures with Consideration of Hybridization Kinetics. LNCS 4848, 119-129 (2008)
 
==Result of Design==
 
::&nbsp;&nbsp;&nbsp;&nbsp;We designed five DNA strands.
 
*The DNA strands
 
:{| border="1"
|'''seqA_azo4_5thiol
|'''[ThiSS]AATXACXCCXAGXCC (X=Azobenzene)
|-
|'''seqAc_5thiol
|'''[ThiSS]GGCTGGGTATT
|-
|'''seqB_5thiol
|'''[ThiSS]CGTCTATTGCTTGTCACTTCCCC
|-
|'''seqBc_5amino
|'''[AminoC6]GGGGAAGTGACAAGCAATAGACG
|-
|'''seqBc_5FAM
|'''[6-FAM]GGGGAAGTGACAAGCAATAGACG
|-
|'''seqB_5thiol_T15
|'''[ThiSS]TTTTTTTTTTTTTTTATTGCTTGTCACTTCCCC
|-
|'''seqBc_5amino_T15
|'''[AminoC6]TTTTTTTTTTTTTTTAGTGACAAGCAATAGACG
|-
|'''seqAc_5thiol_T15
|'''[ThiSS]TTTTTTTTTTTTTTTGGCTGGGTATT
|-
|'''seqB_5FAM
|'''[6-FAM]CGTCTATTGCTTGTCACTTCCCC
|}
 
::&nbsp;&nbsp;&nbsp;&nbsp;(The DNA strands selected by us.)
 
==Reference==

Latest revision as of 22:59, 27 October 2012


<html> <head> <style type="text/css"> /* ====================

  主に全体に関わるCSS

   ==================== */ body.mediawiki {

                       font-size: 14px;

background-image:url(http://openwetware.org/images/2/2d/TNJback.png); background-repeat: repeat; font-family: Calibri, Verdana, helvetica, sans-serif; }

               h1 {
                       padding: 0px 20px 5px 20px;
                       font-size: 34px;
                       line-height: 40px;
                       font-weight: bold;
               }
               h2 {
                       padding: 20px 20px 5px 20px;
                       font-size: 25px;
                       color: #000000;
                       text-decoration: none;
                       font-weight: bold; 
              }
               h2 a {
                       color: #eb8300;
               }
               h3 {
                       padding: 20px 20px 5px 20px;
                       font-size: 20px;
                       color: #000;
                       font-decoration: none;
                       font-weight: bold;
               }
               h1.firstHeading {

display: none;

               }

p { text-align: justify; } a:link { color: #00a5ea; text-decoration: none } a:visited { color:#00a5ea; text-decoration: none } a:hover {

                       color: #eb8300;

text-decoration: none } a:active { color:#f29400; text-decoration: none } #content{ margin: 0px 0 0px 0; align: center; padding: 12px 12px 12px 12px; width: 946px; background-color: #ffff; border: 0; } #bodyContent{ width: 970px; margin: 150px auto 0 auto; align: center; background-color: #ffffff; } #globalWrapper{ margin: 20px 0 0 0; width:994px; background-color: #ffffff; margin-left: auto; margin-right: auto } #biomodlink{ position:absolute;top:0px; width:970px;height:20px; background-color: #ffffff; margin:3px auto 3px auto }


/* ====================

  メニューの画像を変更できる部分
  ==================== */

#header {

                       margin: 0 auto 0 auto;
                       position:absolute;
                       top:28px; width:968px;height:189px;

background-color: #FFFFFF; background-repeat: no-repeat;

                       background-image: url(http://openwetware.org/images/7/74/Title-LOGO6.jpg); 

} /* ====================

  以下、特殊なclassに適用される
  ==================== */

#navigation { position:absolute;

                       top:120px; width:970px; height:92px;
                       background-repeat: no-repeat;

color: #0000FF; }

/* ====================

  ここからプルダウン周辺のデザイン
  ==================== */
  1. menu * {

margin: 0; padding: 0; }

  1. menu {
       position:absolute;

font-family: calibri, verdana, sans-serif;

       font-color: #000000;

background-color: transparent; float:left; display: block; }

  1. menu ul {
       position:relative;

float: left; text-align:center; list-style: none; }

  1. menu li {

background-color:yellow;

       position:relative;

float:left;

       width: 136px;

font-size: 23px;

       font-weight: bold;

border:ridge 0px #FFFFFF; }

  1. menu li.ach {

background-color:yellow;

       position:relative;

float:left;

       width: 162px;

font-size: 23px;

       font-weight: bold;

border:ridge 0px #FFFFFF; }

  1. menu li.sup {

background-color:yellow;

       position:relative;

float:left;

       width: 109px;

font-size: 17px;

       font-weight: bold;

border:ridge 0px #FFFFFF; }

  1. menu li.none {

background-color:yellow;

       position:relative;

float:left;

       width: 152px;

font-size: 17px;

       font-weight: bold;

border:ridge 0px #FFFFFF; }

  1. menu a {

color: #000000; display:block; text-decoration: none; }

  1. menu a:hover {

background-color:gold; }

  1. column-one { display:none; width:0px;}

.container{background-color: #ffffff; margin-top:0px} .OWWNBcpCurrentDateFilled {display: none;}

  1. footer{position: center; width: 994px}

@media screen {

   body { background: #F5F5F5 0 0 no-repeat;  /* changed default background */ }

} </style> </head> <BODY> <div id="biomodlink"> <<a href="http://openwetware.org/wiki/Biomod">BIOMOD</a>|<a href="http://openwetware.org/wiki/Biomod/2012">2012</a>|Titech Nano-Jugglers </div> <div id="header"> <div id="navigation"> <div id="menu"> <ul> <li><a href="http://openwetware.org/wiki/Biomod/2012/Titech/Nano-Jugglers"><br>Home<br><br></a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/Titech/Nano-Jugglers/Team/Students"><br>Team<br><br></a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/Titech/Nano-Jugglers/Project"><br>Project<br><br></a></li> <li><a href="http://openwetware.org/wiki/Biomod/2012/Titech/Nano-Jugglers/Results">Results<br>&<br>Methods</a></font></li> <li class="ach"><a href="http://openwetware.org/wiki/Biomod/2012/Titech/Nano-Jugglers/Achievements"><br>Achievements<br><br></a> <li class="sup"><a href="http://openwetware.org/wiki/Biomod/2012/Titech/Nano-Jugglers/Protocols"><br>Suppl. Info.<br><br></a></li> <li class="none"><a href="http://openwetware.org/wiki/Biomod/2012/Titech/Nano-Jugglers/Acknowledgement"><br>Acknowledgements<br><br></a></li> </ul> </div> </div> </div> </BODY> </html>


0.2. Design of linker DNA strands

    We used DNA strands for bonding between a body of Biomolecular Rocket and platinum particles. DNA strands must be designed 4 DNA strands to hybridize at room temperature stably. DNA strands are categorized into two types, one type was a DNA strand for conjugation to polystyrene surface and its cDNA, and another type was a DNA strand for conjugation to gold surface and its cDNA. Each cDNA conjugated to platinum particles.
    In this section, we explain how we design DNA strands. There are three steps to design DNA strands, first step is selection of DNA strands , second step is adjustment of the number of bases and final step is design of cDNA strand. We used NUPACK[1] for these processes of DNA design. NUPACK is a software for the analysis and design of nucleic acid systems.
    First, we chosed DNA strands from a treatise[2]. In this step, we analyzed whether DNA could easily hybridize at room temperature stably. Then we selected two DNA strands. Secondly, we adjusted number of bases in order to make DNA easily dissociated when they introduced photo-switching systems. Finally, we design complementary DNA of each DNA strands, and modify amino group and thiol group as necessary.
Reference
    [1] NUPACK nucleic acid package. http://www.nupack.org/
    [2] Tetsuro Kitajima, Masahiro Takinoue, Ko-ichiroh Shohda, Akira Suyama. LNCS 4848, 119-129 (2008)
>>back to Results